Construct: ORF TRCN0000489099
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021600.1_s317c1
- DNA Barcode:
- AAACTTCCGAGGCGCTCTATTTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PAX8 (7849)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489099
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7849 | PAX8 | paired box 8 | NM_003466.4 | 100% | 100% | |
| 2 | human | 7849 | PAX8 | paired box 8 | NM_013952.4 | 88.4% | 72.8% | 896_897ins79;1194_1195ins77 |
| 3 | human | 7849 | PAX8 | paired box 8 | NM_013953.4 | 71.3% | 58% | 774_775ins310;963_964ins77 |
| 4 | human | 7849 | PAX8 | paired box 8 | NM_013992.4 | 63.7% | 59.7% | 773_774ins412;861_862ins77 |
| 5 | mouse | 18510 | Pax8 | paired box 8 | NM_011040.4 | 90% | 96.7% | (many diffs) |
| 6 | mouse | 18510 | Pax8 | paired box 8 | XM_006497778.3 | 89.8% | 96.5% | (many diffs) |
| 7 | mouse | 18510 | Pax8 | paired box 8 | XM_006497779.3 | 89.8% | 96.5% | (many diffs) |
| 8 | mouse | 18510 | Pax8 | paired box 8 | XM_006497781.1 | 77.7% | 84.2% | (many diffs) |
| 9 | mouse | 18510 | Pax8 | paired box 8 | XM_006497780.2 | 77.5% | 84% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1422
- ORF length:
- 1350
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcctcac aactccatca gatctggcca tggagggctg aaccagctgg 121 gaggggcctt tgtgaatggc agacctctgc cggaagtggt ccgccagcgc atcgtagacc 181 tggcccacca gggtgtaagg ccctgcgaca tctctcgcca gctccgcgtc agccatggct 241 gcgtcagcaa gatccttggc aggtactacg agactggcag catccggcct ggagtgatag 301 ggggctccaa gcccaaggtg gccaccccca aggtggtgga gaagattggg gactacaaac 361 gccagaaccc taccatgttt gcctgggaga tccgagaccg gctcctggct gagggcgtct 421 gtgacaatga cactgtgccc agtgtcagct ccattaatag aatcatccgg accaaagtgc 481 agcaaccatt caacctccct atggacagct gcgtggccac caagtccctg agtcccggac 541 acacgctgat ccccagctca gctgtaactc ccccggagtc accccagtcg gattccctgg 601 gctccaccta ctccatcaat gggctcctgg gcatcgctca gcctggcagc gacaagagga 661 aaatggatga cagtgatcag gatagctgcc gactaagcat tgactcacag agcagcagca 721 gcggaccccg aaagcacctt cgcacggatg ccttcagcca gcaccacctc gagccgctcg 781 agtgcccatt tgagcggcag cactacccag aggcctatgc ctcccccagc cacaccaaag 841 gcgagcaggg cctctacccg ctgcccttgc tcaacagcac cctggacgac gggaaggcca 901 ccctgacccc ttccaacacg ccactggggc gcaacctctc gactcaccag acctaccccg 961 tggtggcaga tcctcactca cccttcgcca taaagcagga aacccccgag gtgtccagtt 1021 ctagctccac cccttcctct ttatctagct ccgccttttt ggatctgcag caagtcggct 1081 ccggggtccc gcccttcaat gcctttcccc atgctgcctc cgtgtacggg cagttcacgg 1141 gccaggccct cctctcaggg cgagagatgg tggggcccac gctgcccgga tacccacccc 1201 acatccccac cagcggacag ggcagctatg cctCCTCTGC CATCGCAGGC ATGGTGGCAG 1261 GAAGTGAATA CTCTGGCAAT GCCTATGGCC ACACCCCCTA CTCCTCCTAC AGCGAGGCCT 1321 GGCGCTTCCC CAACTCCAGC TTGCTGAGTT CCCCATATTA TTACAGTTCC ACATCAAGGC 1381 CGAGTGCACC GCCCACCACT GCCACGGCCT TTGACCATCT GTAGAACCCA GCTTTCTTGT 1441 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1501 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1561 GAAAGGACGA AAACTTCCGA GGCGCTCTAT TTCCACGCGT TAAGTCgaca atcaacctct 1621 ggattacaaa atttgtgaaa gatt