Construct: ORF TRCN0000489112
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020839.1_s317c1
- DNA Barcode:
- CTCCCCTCTGAGCGAAGTTAGGGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NMUR1 (10316)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489112
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510487.3 | 99.9% | 99.7% | 539G>A |
| 2 | human | 10316 | NMUR1 | neuromedin U receptor 1 | NM_006056.5 | 94.5% | 94.3% | 1_69del;608G>A |
| 3 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712195.3 | 74.3% | 67.4% | (many diffs) |
| 4 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510488.2 | 72.2% | 65.6% | (many diffs) |
| 5 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712196.3 | 68.6% | 65% | (many diffs) |
| 6 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510489.2 | 67.4% | 65.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1281
- ORF length:
- 1209
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcttgc aatggcagtg cggccagggg gcactttgac cctgaggact 121 tgaacctgac tgacgaggca ctgagactca agtacctggg gccccagcag acagagctgt 181 tcatgcccat ctgtgccaca tacctgctga tcttcgtggt gggcgctgtg ggcaatgggc 241 tgacctgtct ggtcatcctg cgccacaagg ccatgcgcac gcctaccaac tactacctct 301 tcagcctggc cgtgtcggac ctgctggtgc tgctggtggg cctgcccctg gagctctatg 361 agatgtggca caactacccc ttcctgctgg gcgttggtgg ctgctatttc cgcacgctac 421 tgtttgagat ggtctgcctg gcctcagtgc tcaacgtcac tgccctgagc gtggaacgct 481 atgtggccgt ggtgcaccca ctccaggcca ggtccatggt gacgcgggcc catgtgcgcc 541 gagtgcttgg ggccgtctgg ggtcttgcca tgctctgctc cctgcccaac accagcctgc 601 acggcatcca gcagctgcac gtgccctgcc ggggcccagt gccagactca gctgtttgca 661 tgctggtccg cccacgggcc ctctacaaca tggtagtgca gaccaccgcg ctgctcttct 721 tctgcctgcc catggccatc atgagcgtgc tctacctgct cattgggctg cgactgcggc 781 gggagaggct gctgctcatg caggaggcca agggcagggg ctctgcagca gccaggtcca 841 gatacacctg caggctccag cagcacgatc ggggccggag acaagtgacc aagatgctgt 901 ttgtcctggt cgtggtgttt ggcatctgct gggccccgtt ccacgccgac cgcgtcatgt 961 ggagcgtcgt gtcacagtgg acagatggcc tgcacctggc cttccagcac gtgcacgtca 1021 tcTCCGGCAT CTTCTTCTAC CTGGGCTCGG CGGCCAACCC CGTGCTCTAT AGCCTCATGT 1081 CCAGCCGCTT CCGAGAGACC TTCCAGGAGG CCCTGTGCCT CGGGGCCTGC TGCCATCGCC 1141 TCAGACCCCG CCACAGCTCC CACAGCCTCA GCAGGATGAC CACAGGCAGC ACCCTGTGTG 1201 ATGTGGGCTC CCTGGGCAGC TGGGTCCACC CCCTGGCTGG GAACGATGGC CCAGAGGCGC 1261 AGCAAGAGAC CGATCCATCC TAGGACCCAG TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 1321 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 1381 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACT CCCCTCTGAG 1441 CGAAGTTAGG GTACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 1501 tt