Construct: ORF TRCN0000489191
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020142.1_s317c1
- DNA Barcode:
- CTGATGCCGCCGCGGCGTTTTATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AURKB (9212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489191
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9212 | AURKB | aurora kinase B | NM_001313950.2 | 99.8% | 99.7% | 885C>T;893T>C |
| 2 | human | 9212 | AURKB | aurora kinase B | NM_004217.4 | 99.8% | 99.7% | 885C>T;893T>C |
| 3 | human | 9212 | AURKB | aurora kinase B | NM_001284526.2 | 99.5% | 99.4% | 207_209delCAG;888C>T;896T>C |
| 4 | human | 9212 | AURKB | aurora kinase B | NM_001313953.3 | 88.7% | 86.9% | (many diffs) |
| 5 | human | 9212 | AURKB | aurora kinase B | NM_001256834.3 | 87.8% | 87.7% | 0_1ins123;762C>T;770T>C |
| 6 | human | 9212 | AURKB | aurora kinase B | NM_001313951.1 | 87.8% | 87.7% | 0_1ins123;762C>T;770T>C |
| 7 | human | 9212 | AURKB | aurora kinase B | XM_011524072.3 | 87.8% | 87.7% | 0_1ins123;762C>T;770T>C |
| 8 | human | 9212 | AURKB | aurora kinase B | XM_017025307.2 | 87.8% | 87.7% | 0_1ins123;762C>T;770T>C |
| 9 | human | 9212 | AURKB | aurora kinase B | NM_001313952.2 | 87.6% | 87.5% | (many diffs) |
| 10 | human | 9212 | AURKB | aurora kinase B | XM_017025308.2 | 76.9% | 75% | (many diffs) |
| 11 | human | 9212 | AURKB | aurora kinase B | NR_132731.1 | 74.4% | (many diffs) | |
| 12 | human | 9212 | AURKB | aurora kinase B | NR_132730.2 | 71.4% | (many diffs) | |
| 13 | human | 9212 | AURKB | aurora kinase B | NM_001313954.2 | 54.1% | 48.9% | (many diffs) |
| 14 | human | 9212 | AURKB | aurora kinase B | XM_017025309.1 | 54.1% | 48.9% | (many diffs) |
| 15 | human | 9212 | AURKB | aurora kinase B | XM_017025310.1 | 54.1% | 48.9% | (many diffs) |
| 16 | human | 9212 | AURKB | aurora kinase B | XM_017025311.1 | 54.1% | 48.9% | (many diffs) |
| 17 | human | 9212 | AURKB | aurora kinase B | NM_001313955.2 | 50% | 47.2% | (many diffs) |
| 18 | mouse | 20877 | Aurkb | aurora kinase B | NM_011496.2 | 81.4% | 82.9% | (many diffs) |
| 19 | mouse | 20877 | Aurkb | aurora kinase B | XM_006532725.3 | 53.7% | 55% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1104
- ORF length:
- 1032
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcccag aaggagaact cctacccctg gccctacggc cgacagacgg 121 ctccatctgg cctgagcacc ctgccccagc gagtcctccg gaaagagcct gtcaccccat 181 ctgcacttgt cctcatgagc cgctccaatg tccagcccac agctgcccct ggccagaagg 241 tgatggagaa tagcagtggg acacccgaca tcttaacgcg gcacttcaca attgatgact 301 ttgagattgg gcgtcctctg ggcaaaggca agtttggaaa cgtgtacttg gctcgggaga 361 agaaaagcca tttcatcgtg gcgctcaagg tcctcttcaa gtcccagata gagaaggagg 421 gcgtggagca tcagctgcgc agagagatcg aaatccaggc ccacctgcac catcccaaca 481 tcctgcgtct ctacaactat ttttatgacc ggaggaggat ctacttgatt ctagagtatg 541 ccccccgcgg ggagctctac aaggagctgc agaagagctg cacatttgac gagcagcgaa 601 cagccacgat catggaggag ttggcagatg ctctaatgta ctgccatggg aagaaggtga 661 ttcacagaga cataaagcca gaaaatctgc tcttagggct caagggagag ctgaagattg 721 ctgacttcgg ctggtctgtg catgcgccct cccTGAGGAG GAAGACAATG TGTGGCACCC 781 TGGACTACCT GCCCCCAGAG ATGATTGAGG GGCGCATGCA CAATGAGAAG GTGGATCTGT 841 GGTGCATTGG AGTGCTTTGC TATGAGCTGC TGGTGGGGAA CCCACCCTTT GAGAGTGCAT 901 CACACAACGA GACCTATCGC CGCATCGTCA AGGTGGACCT AAAGTTCCCC GCTTCTGTGC 961 CCACGGGAGC CCAGGACCTC ATCTCCAAAC TGCTCAGGCA TAACCCCTCG GAACGGCTGC 1021 CCCTGGCCCA GGTCTCAGCC CACCCTTGGG TCCGGGCCAA CTCTCGGAGG GTGCTGCCTC 1081 CCTCTGCCCT TCAATCTGTC GCCTGAGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1141 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1201 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACTGATGCC 1261 GCCGCGGCGT TTTATTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1321 aagatt