Transcript: Mouse NM_011496.2

Mus musculus aurora kinase B (Aurkb), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Aurkb (20877)
Length:
1981
CDS:
325..1362

Additional Resources:

NCBI RefSeq record:
NM_011496.2
NBCI Gene record:
Aurkb (20877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374360 CTTCGCCGAGAGATCGAAATC pLKO_005 703 CDS 100% 10.800 15.120 N Aurkb n/a
2 TRCN0000028780 CGCATGCATAATGAAATGGTA pLKO.1 1081 CDS 100% 3.000 4.200 N Aurkb n/a
3 TRCN0000028760 GCAGCCTTTCACTATTGACAA pLKO.1 546 CDS 100% 4.950 3.960 N Aurkb n/a
4 TRCN0000028774 CCAGCAGAGGATCTACTTAAT pLKO.1 777 CDS 100% 13.200 9.240 N Aurkb n/a
5 TRCN0000321718 CCAGCAGAGGATCTACTTAAT pLKO_005 777 CDS 100% 13.200 9.240 N Aurkb n/a
6 TRCN0000374361 TGCCACAAGAAGAAGGTAATT pLKO_005 910 CDS 100% 13.200 9.240 N Aurkb n/a
7 TRCN0000028756 CCTTCAACTCTACAACTACTT pLKO.1 750 CDS 100% 4.950 3.465 N Aurkb n/a
8 TRCN0000321651 CCTTCAACTCTACAACTACTT pLKO_005 750 CDS 100% 4.950 3.465 N Aurkb n/a
9 TRCN0000028840 CTCATCTCCAAGCTGCTCAAA pLKO.1 1246 CDS 100% 4.950 3.465 N Aurkb n/a
10 TRCN0000321719 CTCATCTCCAAGCTGCTCAAA pLKO_005 1246 CDS 100% 4.950 3.465 N Aurkb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489191 CTGATGCCGCCGCGGCGTTTTATT pLX_317 34.3% 81.4% 82.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_02108 pDONR223 100% 81.3% 82.9% None (many diffs) n/a
3 ccsbBroad304_02108 pLX_304 0% 81.3% 82.9% V5 (many diffs) n/a
4 TRCN0000471659 GTACGGTTTCTTGAGACCCTTTAC pLX_317 40.3% 81.3% 82.9% V5 (many diffs) n/a
5 ccsbBroadEn_14932 pDONR223 0% 81.3% 82.9% None (many diffs) n/a
6 ccsbBroad304_14932 pLX_304 0% 81.3% 82.9% V5 (many diffs) n/a
7 TRCN0000474845 GGCTCCACACATCCACTGCTTAGC pLX_317 48.2% 81.3% 82.9% V5 (many diffs) n/a
8 TRCN0000488915 ATCAAATATCTTTTAGGCTAAAAC pLX_317 34.3% 81.3% 82.9% V5 (many diffs) n/a
Download CSV