Transcript: Human NM_001313950.2

Homo sapiens aurora kinase B (AURKB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AURKB (9212)
Length:
1219
CDS:
48..1082

Additional Resources:

NCBI RefSeq record:
NM_001313950.2
NBCI Gene record:
AURKB (9212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000777 CCTGCGTCTCTACAACTATTT pLKO.1 458 CDS 100% 13.200 18.480 N AURKB n/a
2 TRCN0000344504 CCTGCGTCTCTACAACTATTT pLKO_005 458 CDS 100% 13.200 18.480 N AURKB n/a
3 TRCN0000000776 CTACCTCCTCCTTTGTTTAAT pLKO.1 1175 3UTR 100% 15.000 12.000 N AURKB n/a
4 TRCN0000344570 CTACCTCCTCCTTTGTTTAAT pLKO_005 1175 3UTR 100% 15.000 12.000 N AURKB n/a
5 TRCN0000219657 TTAACGCGGCACTTCACAATT pLKO.1 249 CDS 100% 13.200 9.240 N AURKB n/a
6 TRCN0000332971 TTAACGCGGCACTTCACAATT pLKO_005 249 CDS 100% 13.200 9.240 N AURKB n/a
7 TRCN0000195436 CATCGTCAAGGTGGACCTAAA pLKO.1 899 CDS 100% 10.800 7.560 N AURKB n/a
8 TRCN0000199233 CCATCTGCACTTGTCCTCATG pLKO.1 153 CDS 100% 4.050 2.835 N AURKB n/a
9 TRCN0000000779 GAAGAGCTGCACATTTGACGA pLKO.1 548 CDS 100% 2.640 1.848 N AURKB n/a
10 TRCN0000353008 GAAGAGCTGCACATTTGACGA pLKO_005 548 CDS 100% 2.640 1.848 N AURKB n/a
11 TRCN0000000778 TGATGGAGAATAGCAGTGGGA pLKO.1 217 CDS 100% 0.660 0.462 N AURKB n/a
12 TRCN0000199198 CAGCGAGTCCTCCGGAAAGAG pLKO.1 123 CDS 100% 0.000 0.000 N AURKB n/a
13 TRCN0000353066 CAGCGAGTCCTCCGGAAAGAG pLKO_005 123 CDS 100% 0.000 0.000 N AURKB n/a
14 TRCN0000010547 GCATCACACAACGAGACCTAT pLKO.1 873 CDS 100% 4.950 2.970 N AURKB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02108 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02108 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471659 GTACGGTTTCTTGAGACCCTTTAC pLX_317 40.3% 100% 100% V5 n/a
4 ccsbBroadEn_14932 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14932 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000474845 GGCTCCACACATCCACTGCTTAGC pLX_317 48.2% 100% 100% V5 n/a
7 TRCN0000488915 ATCAAATATCTTTTAGGCTAAAAC pLX_317 34.3% 99.8% 99.7% V5 893T>C;1017C>T n/a
8 TRCN0000489191 CTGATGCCGCCGCGGCGTTTTATT pLX_317 34.3% 99.8% 99.7% V5 (not translated due to prior stop codon) 885C>T;893T>C n/a
Download CSV