Construct: ORF TRCN0000489204
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019477.1_s317c1
- DNA Barcode:
- AGCGCCGTTGGGCGTACGATATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACKR3 (57007)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489204
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | NM_020311.3 | 99.8% | 99.7% | 162C>T;1086_1087insG |
| 2 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246097.3 | 99.8% | 99.7% | 162C>T;1086_1087insG |
| 3 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_005246098.3 | 99.8% | 99.7% | 162C>T;1086_1087insG |
| 4 | human | 57007 | ACKR3 | atypical chemokine receptor 3 | XM_017004516.2 | 99.8% | 99.7% | 162C>T;1086_1087insG |
| 5 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_001271607.1 | 88.5% | 92.5% | (many diffs) |
| 6 | mouse | 12778 | Ackr3 | atypical chemokine receptor 3 | NM_007722.4 | 88.5% | 92.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1164
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggat ctgcatctct tcgactactc agagccaggg aacttctcgg 121 acatcagctg gccatgcaac agcagcgact gcatcgtggt ggacacggtg atgtgtccca 181 acatgcccaa caaaagcgtc ctgctctaca cgctctcctt catttacatt ttcattttcg 241 tcatcggcat gattgccaac tccgtggtgg tctgggtgaa tatccaggcc aagaccacag 301 gctatgacac gcactgctac atcttgaacc tggccattgc cgacctgtgg gttgtcctca 361 ccatcccagt ctgggtggtc agtctcgtgc agcacaacca gtggcccatg ggcgagctca 421 cgtgcaaagt cacacacctc atcttctcca tcaacctctt cggcagcatt ttcttcctca 481 cgtgcatgag cgtggaccgc tacctctcca tcacctactt caccaacacc cccagcagca 541 ggaagaagat ggtacgccgt gtcgtctgca tcctggtgtg gctgctggcc ttctgcgtgt 601 ctctgcctga cacctactac ctgaagaccg tcacgtctgc gtccaacaat gagacctact 661 gccggtcctt ctaccccgag cacagcatca aggagtggct gatcggcatg gagctggtct 721 ccgttgtctt gggctttgcc gttcccttct ccattatcgc tgtcttctac ttcctgctgg 781 ccagagccat ctcggcgtcc agtgaccagg agaagcacag cagccggaag atcatcttct 841 ccTACGTGGT GGTCTTCCTT GTCTGCTGGC TGCCCTACCA CGTGGCGGTG CTGCTGGACA 901 TCTTCTCCAT CCTGCACTAC ATCCCTTTCA CCTGCCGGCT GGAGCACGCC CTCTTCACGG 961 CCCTGCATGT CACACAGTGC CTGTCGCTGG TGCACTGCTG CGTCAACCCT GTCCTCTACA 1021 GCTTCATCAA TCGCAACTAC AGGTACGAGC TGATGAAGGC CTTCATCTTC AAGTACTCGG 1081 CCAAAACAGG GCTCACCAAG CTCATCGATG CCTCCAGAGT CTCAGAGACG GAGTACTCTG 1141 CCTTGGAGCA GAGCACCAAA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGCG CCGTTGGGCG 1321 TACGATATCT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt