Construct: ORF TRCN0000489210
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021499.1_s317c1
- DNA Barcode:
- AGACGGATTCCTACTAATTGTCAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489210
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 100% | 100% | |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 92.3% | 92.3% | 131_217del |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 91.9% | 91.9% | 649_741del |
| 4 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 85.8% | 85.8% | 132_305del |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 85.4% | 85.4% | 131_217del;736_828del |
| 6 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 79.8% | 79.8% | 132_305del;823_915del |
| 7 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 78.3% | 78.3% | 252_449del;847_939del |
| 8 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 73.6% | 73.6% | 131_217del;339_536del;934_1026del |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 69.4% | 69.4% | 132_305del;426_623del;1021_1113del |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 46.4% | 46.4% | (many diffs) |
| 11 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 46% | 46% | 132_305del;371_1435del |
| 12 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 45.3% | 45.3% | (many diffs) |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 44.2% | 44.2% | 132_305del;371_1435del;1888_1980del |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 43.7% | 43.7% | 197_1261del;1317_1514del;1912_2004del |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 42.3% | 42.3% | 132_305del;371_1435del;1491_1688del |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 42.2% | 42.2% | (many diffs) |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 40.8% | 40.8% | (many diffs) |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 82.4% | 88.1% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 77.3% | 82.4% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 76.1% | 81.4% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 75.7% | 81% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 71.1% | 76.1% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 70.9% | 75.7% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 70.4% | 75.3% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 66% | 70.4% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 38.1% | 40.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1125
- ORF length:
- 1056
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gctgaagaag caggcattgg agacaccccc agcctggaag 241 acgaagctgc tggtcacgtg acccaagctc gcatggtcag taaaagcaaa gacgggactg 301 gaagcgatga caaaaaagcc aagggggctg atggtaaaac gaagatcgcc acaccgcggg 361 gagcagcccc tccaggccag aagggccagg ccaacgccac caggattcca gcaaaaaccc 421 cgcccgctcc aaagacacca cccagctctg gtgaacctcc aaaatcaggg gatcgcagcg 481 gctacagcag ccccggctcc ccaggcactc ccggcagccg ctcccgcacc ccgtcccttc 541 caaccccacc cacccgggag cccaagaagg tggcagtggt ccgtactcca cccaagtcgc 601 cgtcttccgc caagagccgc ctgcagacag cccccgtgcc catgccagac ctgaagaatg 661 tcaagtccaa gatcggctcc actgagaacc tgaagcacca gccgggaggc gggaaggtgc 721 aaatagtcta caaaccagtt gacctgagca aggtgacctc caagtgtggc tcattaggca 781 acatccatca taaaccagga ggtggccagg tggaagtaaa atcTGAGAAG CTTGACTTCA 841 AGGACAGAGT CCAGTCGAAG ATTGGGTCCC TGGACAATAT CACCCACGTC CCTGGCGGAG 901 GAAATAAAAA GATTGAAACC CACAAGCTGA CCTTCCGCGA GAACGCCAAA GCCAAGACAG 961 ACCACGGGGC GGAGATCGTG TACAAGTCGC CAGTGGTGTC TGGGGACACG TCTCCACGGC 1021 ATCTCAGCAA TGTCTCCTCC ACCGGCAGCA TCGACATGGT AGACTCGCCC CAGCTCGCCA 1081 CGCTAGCTGA CGAGGTGTCT GCCTCCCTGG CCAAGCAGGG TTTGTGAGAC CCAGCTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGAAGACGGA TTCCTACTAA TTGTCAGACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt