Transcript: Mouse XM_006532408.3

PREDICTED: Mus musculus microtubule-associated protein tau (Mapt), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mapt (17762)
Length:
5397
CDS:
295..1494

Additional Resources:

NCBI RefSeq record:
XM_006532408.3
NBCI Gene record:
Mapt (17762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091302 TGGAGCAGAAATTGTGTATAA pLKO.1 1332 CDS 100% 13.200 9.240 N Mapt n/a
2 TRCN0000415611 ACAGAGTCCAGTCGAAGATTG pLKO_005 1211 CDS 100% 10.800 7.560 N MAPT n/a
3 TRCN0000091298 ACAGGAAATGACGAGAAGAAA pLKO.1 658 CDS 100% 5.625 3.938 N Mapt n/a
4 TRCN0000091300 GACAGAGTCCAGTCGAAGATT pLKO.1 1210 CDS 100% 5.625 3.938 N Mapt n/a
5 TRCN0000091299 GTTAGGGAACATCCATCACAA pLKO.1 1140 CDS 100% 4.950 3.465 N Mapt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488920 CAATCAGCTAGGCTTACGTGGGGC pLX_317 30.2% 82.6% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489265 TAAAGTCAATTACTGTATAGATGC pLX_317 26.3% 76.8% 81.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489485 TCAGAACGAACATCTAAGATCTCT pLX_317 28% 76.8% 81.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488697 AGATCTAAGGGCGCCCCACTAGCC pLX_317 28.1% 76.8% 81.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489653 TCATCCCTTTTTCTTCACCTTATA pLX_317 33.4% 76.4% 81.3% V5 (many diffs) n/a
6 TRCN0000488263 CTATACCCTTTCCCTAGATCAACC pLX_317 25.7% 72.7% 76.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489602 TGCAGCAGCAGTCACCCCGGTGCG pLX_317 31.1% 71.1% 75.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489600 CGCCCGGTTAACGGTCCACACAAC pLX_317 30.5% 71.1% 75.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488627 ATCCATCTCCACAGGTGGATTGCA pLX_317 30.1% 71.1% 75.8% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000491761 TCTTCCCTGGCGGTGGTGTGACCC pLX_317 31% 71% 75.6% V5 (many diffs) n/a
11 TRCN0000488420 ACCAAGTGGCGACCCGGCACATGC pLX_317 31% 71% 75.6% V5 (many diffs) n/a
12 TRCN0000489514 ATGGGGGTCTATGAAACTGGAGAA pLX_317 27.4% 71% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
13 TRCN0000488826 GGCCCCATGATCTCATTCTTTTAC pLX_317 31.2% 71% 75.8% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000491690 TCGTACACCCAAAATGCCAAGGTC pLX_317 31% 70.9% 75.4% V5 (many diffs) n/a
15 TRCN0000491287 TTTAATTGATCTAATCTACTCAAT pLX_317 24.7% 70.9% 75.6% V5 (many diffs) n/a
16 TRCN0000489210 AGACGGATTCCTACTAATTGTCAG pLX_317 29.1% 70.9% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
17 ccsbBroadEn_00973 pDONR223 100% 66% 70.4% None (many diffs) n/a
18 ccsbBroad304_00973 pLX_304 0% 66% 70.4% V5 (many diffs) n/a
19 TRCN0000480553 GCCGGAGTCGAAAGACCATACAGA pLX_317 33.3% 66% 70.4% V5 (many diffs) n/a
20 TRCN0000489348 TTCGATTCCAATTCTGAGTTCTTA pLX_317 30.2% 66% 70.4% V5 (not translated due to prior stop codon) (many diffs) n/a
21 TRCN0000489050 CTCCCAGCGGGGCTTAGTTTTTAA pLX_317 26.8% 66% 70.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV