Construct: ORF TRCN0000489331
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020173.1_s317c1
- DNA Barcode:
- AAAACCCGTACCATGTAATGTTAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- LCK (3932)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489331
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | NM_001042771.2 | 94.4% | 94.4% | 963_964ins90 |
| 2 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | NM_005356.5 | 94.4% | 94.4% | 963_964ins90 |
| 3 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | XM_024447046.1 | 85.2% | 85.2% | 186_359del;1137_1138ins90 |
| 4 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | XM_024447047.1 | 85.2% | 85.2% | 186_359del;1137_1138ins90 |
| 5 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | NM_001330468.2 | 84.9% | 84.7% | 631_632ins153;810_811ins90 |
| 6 | human | 3932 | LCK | LCK proto-oncogene, Src fam... | XM_011541453.3 | 76.7% | 76.5% | 186_359del;805_806ins153;984_985ins90 |
| 7 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | NM_001162433.1 | 83.7% | 91.4% | (many diffs) |
| 8 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | NM_010693.3 | 83.7% | 91.4% | (many diffs) |
| 9 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | XM_006502818.3 | 83.7% | 91.4% | (many diffs) |
| 10 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | XM_030253275.1 | 83.7% | 91.4% | (many diffs) |
| 11 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | XM_030253276.1 | 83.7% | 91.4% | (many diffs) |
| 12 | mouse | 16818 | Lck | lymphocyte protein tyrosine... | NM_001162432.1 | 82% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1689
- ORF length:
- 1617
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggctgt ggctgcagct cacacccgga agatgactgg atggaaaaca 121 tcgatgtgtg tgagaactgc cattatccca tagtcccact ggatggcaag ggcacgctgc 181 tcatccgaaa tggctctgag gtgcgggacc cactggttac ctacgaaggc tccaatccgc 241 cggcttcccc actgcaagac aacctggtta tcgctctgca cagctatgag ccctctcacg 301 acggagatct gggctttgag aagggggaac agctccgcat cctggagcag agcggcgagt 361 ggtggaaggc gcagtccctg accacgggcc aggaaggctt catccccttc aattttgtgg 421 ccaaagcgaa cagcctggag cccgaaccct ggttcttcaa gaacctgagc cgcaaggacg 481 cggagcggca gctcctggcg cccgggaaca ctcacggctc cttcctcatc cgggagagcg 541 agagcaccgc gggatcgttt tcactgtcgg tccgggactt cgaccagaac cagggagagg 601 tggtgaaaca ttacaagatc cgtaatctgg acaacggtgg cttctacatc tcccctcgaa 661 tcacttttcc cggcctgcat gaactggtcc gccattacac caatgcttca gatgggctgt 721 gcacacggtt gagccgcccc tgccagaccc agaagcccca gaagccgtgg tgggaggacg 781 agtgggaggt tcccagggag acgctgaagc tggtggagcg gctgggggct ggacagttcg 841 gggaggtgtg gatggggtac tacaacgggc acacgaaggt ggcggtgaag agcctgaagc 901 agggcagcat gtccccggac gccttcctgg ccgaggccaa cctcatgaag cagctgcaac 961 accagcggct ggttcggctc tacgctgtgg tcacccagga gcccatctac atcatcactg 1021 aatacatgga gaatgacaca cttctagact cccagttgga ggagaaaggt ctgggggcct 1081 ccccctgggg caacttgggc cagcaactct tgcttctgcc cacagggagt ctagtggatt 1141 ttctcaagac cccttcaggc atcaagttga ccatcaacaa actcctggac atggcagccc 1201 aaattgcaga aggcatggca ttcattgaag agcggaatta tattcatcgt gaccttcggg 1261 ctgccaacat tctggtgtct gacaccctga gctgcaagat tgcagacttt ggccTAGCAC 1321 GCCTCATTGA GGACAACGAG TACACAGCCA GGGAGGGGGC CAAGTTTCCC ATTAAGTGGA 1381 CAGCGCCAGA AGCCATTAAC TACGGGACAT TCACCATCAA GTCAGATGTG TGGTCTTTTG 1441 GGATCCTGCT GACGGAAATT GTCACCCACG GCCGCATCCC TTACCCAGGG ATGACCAACC 1501 CGGAGGTGAT TCAGAACCTG GAGCGAGGCT ACCGCATGGT GCGCCCTGAC AACTGTCCAG 1561 AGGAGCTGTA CCAACTCATG AGGCTGTGCT GGAAGGAGCG CCCAGAGGAC CGGCCCACCT 1621 TTGACTACCT GCGCAGTGTG CTGGAGGACT TCTTCACGGC CACAGAGGGC CAGTACCAGC 1681 CTCAGCCTTG AGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1741 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1801 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAA ACCCGTACCA TGTAATGTTA 1861 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t