Transcript: Human XM_024447047.1

PREDICTED: Homo sapiens LCK proto-oncogene, Src family tyrosine kinase (LCK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LCK (3932)
Length:
2270
CDS:
118..1821

Additional Resources:

NCBI RefSeq record:
XM_024447047.1
NBCI Gene record:
LCK (3932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335893 GCATGAACTGGTCCGCCATTA pLKO_005 897 CDS 100% 10.800 15.120 N LCK n/a
2 TRCN0000356313 GCCATTAACTACGGGACATTC pLKO_005 1522 CDS 100% 10.800 15.120 N LCK n/a
3 TRCN0000001601 AGCGCCAGAAGCCATTAACTA pLKO.1 1512 CDS 100% 5.625 7.875 N LCK n/a
4 TRCN0000001599 AGCCATTAACTACGGGACATT pLKO.1 1521 CDS 100% 4.950 6.930 N LCK n/a
5 TRCN0000010178 TACTACAACGGGCACACGAAG pLKO.1 1078 CDS 100% 4.050 5.670 N LCK n/a
6 TRCN0000335896 TTCATTGAAGAGCGGAATTAT pLKO_005 1351 CDS 100% 15.000 10.500 N LCK n/a
7 TRCN0000010176 GACAGCGCCAGAAGCCATTAA pLKO.1 1509 CDS 100% 13.200 9.240 N LCK n/a
8 TRCN0000001598 GCACACATCAGGAGTTCAATA pLKO.1 2227 3UTR 100% 13.200 9.240 N LCK n/a
9 TRCN0000335810 GGGATCCTGCTGACGGAAATT pLKO_005 1570 CDS 100% 13.200 9.240 N LCK n/a
10 TRCN0000335894 TCACATGGCCTATGCACATAT pLKO_005 1898 3UTR 100% 13.200 9.240 N LCK n/a
11 TRCN0000426292 GAATGGGAGTCTAGTGGATTT pLKO_005 1251 CDS 100% 10.800 7.560 N LCK n/a
12 TRCN0000010175 GACACCCTGAGCTGCAAGATT pLKO.1 1411 CDS 100% 5.625 3.938 N LCK n/a
13 TRCN0000001600 CATCAACAAACTCCTGGACAT pLKO.1 1302 CDS 100% 4.050 2.835 N LCK n/a
14 TRCN0000356312 TGTGTAGCCTGTGCATGTATG pLKO_005 2017 3UTR 100% 10.800 6.480 N LCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14688 pDONR223 0% 89.7% 89.7% None 186_359del n/a
2 ccsbBroad304_14688 pLX_304 26.4% 89.7% 89.7% V5 186_359del n/a
3 TRCN0000480260 TAAGTGCCAAACCCGCCCCTCGTC pLX_317 24.6% 89.7% 89.7% V5 186_359del n/a
4 TRCN0000488100 TATGTCATCCAAGTGGGACCAATC pLX_317 19.7% 89.7% 89.7% V5 186_359del n/a
5 TRCN0000489331 AAAACCCGTACCATGTAATGTTAC pLX_317 23.5% 85.2% 85.2% V5 (not translated due to prior stop codon) 186_359del;1137_1138ins90 n/a
6 TRCN0000491798 CTTCTGGTCGTGTGGGCTGGGTCC pLX_317 18.3% 85.2% 85.2% V5 (not translated due to prior stop codon) 186_359del;1137_1138ins90 n/a
7 ccsbBroadEn_13891 pDONR223 100% 85.1% 84.5% None (many diffs) n/a
8 ccsbBroad304_13891 pLX_304 0% 85.1% 84.5% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000479854 GATATTGTCGAACACGCCTCACTG pLX_317 22.9% 85.1% 84.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV