Transcript: Human NM_001042771.2

Homo sapiens LCK proto-oncogene, Src family tyrosine kinase (LCK), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LCK (3932)
Length:
2102
CDS:
122..1651

Additional Resources:

NCBI RefSeq record:
NM_001042771.2
NBCI Gene record:
LCK (3932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145503 GCTGGTTCGGCTCTACGCTG pXPR_003 TGG 913 60% 9 0.7585 LCK LCK 76412
2 BRDN0001145572 GCCGGGAAAAGTGATTCGAG pXPR_003 GGG 586 38% 7 0.4147 LCK LCK 76411
3 BRDN0001145758 CTACAACGGGCACACGAAGG pXPR_003 TGG 805 53% 9 0.3291 LCK LCK 76413
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335893 GCATGAACTGGTCCGCCATTA pLKO_005 727 CDS 100% 10.800 15.120 N LCK n/a
2 TRCN0000356313 GCCATTAACTACGGGACATTC pLKO_005 1352 CDS 100% 10.800 15.120 N LCK n/a
3 TRCN0000001601 AGCGCCAGAAGCCATTAACTA pLKO.1 1342 CDS 100% 5.625 7.875 N LCK n/a
4 TRCN0000001599 AGCCATTAACTACGGGACATT pLKO.1 1351 CDS 100% 4.950 6.930 N LCK n/a
5 TRCN0000010178 TACTACAACGGGCACACGAAG pLKO.1 908 CDS 100% 4.050 5.670 N LCK n/a
6 TRCN0000335896 TTCATTGAAGAGCGGAATTAT pLKO_005 1181 CDS 100% 15.000 10.500 N LCK n/a
7 TRCN0000010176 GACAGCGCCAGAAGCCATTAA pLKO.1 1339 CDS 100% 13.200 9.240 N LCK n/a
8 TRCN0000001598 GCACACATCAGGAGTTCAATA pLKO.1 2057 3UTR 100% 13.200 9.240 N LCK n/a
9 TRCN0000335810 GGGATCCTGCTGACGGAAATT pLKO_005 1400 CDS 100% 13.200 9.240 N LCK n/a
10 TRCN0000335894 TCACATGGCCTATGCACATAT pLKO_005 1728 3UTR 100% 13.200 9.240 N LCK n/a
11 TRCN0000426292 GAATGGGAGTCTAGTGGATTT pLKO_005 1081 CDS 100% 10.800 7.560 N LCK n/a
12 TRCN0000010175 GACACCCTGAGCTGCAAGATT pLKO.1 1241 CDS 100% 5.625 3.938 N LCK n/a
13 TRCN0000010177 CACTGCAAGACAACCTGGTTA pLKO.1 300 CDS 100% 4.950 3.465 N LCK n/a
14 TRCN0000055434 CACTGCAAGACAACCTGGTTA pLKO.1 300 CDS 100% 4.950 3.465 N LCK n/a
15 TRCN0000001600 CATCAACAAACTCCTGGACAT pLKO.1 1132 CDS 100% 4.050 2.835 N LCK n/a
16 TRCN0000356312 TGTGTAGCCTGTGCATGTATG pLKO_005 1847 3UTR 100% 10.800 6.480 N LCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14688 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14688 pLX_304 26.4% 100% 100% V5 n/a
3 TRCN0000480260 TAAGTGCCAAACCCGCCCCTCGTC pLX_317 24.6% 100% 100% V5 n/a
4 TRCN0000488100 TATGTCATCCAAGTGGGACCAATC pLX_317 19.7% 100% 100% V5 n/a
5 TRCN0000489331 AAAACCCGTACCATGTAATGTTAC pLX_317 23.5% 94.4% 94.4% V5 (not translated due to prior stop codon) 963_964ins90 n/a
6 TRCN0000491798 CTTCTGGTCGTGTGGGCTGGGTCC pLX_317 18.3% 94.4% 94.4% V5 (not translated due to prior stop codon) 963_964ins90 n/a
7 ccsbBroadEn_13891 pDONR223 100% 94.3% 93.6% None 9T>C;963_964ins90;1516C>T n/a
8 ccsbBroad304_13891 pLX_304 0% 94.3% 93.6% V5 (not translated due to prior stop codon) 9T>C;963_964ins90;1516C>T n/a
9 TRCN0000479854 GATATTGTCGAACACGCCTCACTG pLX_317 22.9% 94.3% 93.6% V5 (not translated due to prior stop codon) 9T>C;963_964ins90;1516C>T n/a
Download CSV