Construct: ORF TRCN0000489348
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021929.1_s317c1
- DNA Barcode:
- TTCGATTCCAATTCTGAGTTCTTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489348
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 99.9% | 99.7% | 728C>T |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 92.8% | 92.7% | 131_217del;815C>T |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 91.9% | 91.9% | 648_649ins93 |
| 4 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 86.7% | 86.6% | 132_305del;902C>T |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 85.4% | 85.4% | 131_217del;735_736ins93 |
| 6 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 85.2% | 85% | 252_449del;926C>T |
| 7 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 80% | 79.9% | 131_217del;339_536del;1013C>T |
| 8 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 79.8% | 79.8% | 132_305del;822_823ins93 |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 75.4% | 75.3% | 132_305del;426_623del;1100C>T |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 50.4% | 50.3% | (many diffs) |
| 11 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 49.3% | 49.2% | (many diffs) |
| 12 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 48% | 47.9% | 132_305del;371_1435del;1967C>T |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 47.5% | 47.5% | 197_1261del;1317_1514del;1991C>T |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 45.9% | 45.8% | (many diffs) |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 44.3% | 44.3% | (many diffs) |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 44.2% | 44.2% | 132_305del;371_1435del;1887_1888ins93 |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 40.8% | 40.8% | (many diffs) |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 83.4% | 88.8% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 78.8% | 83.8% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 77.6% | 82.6% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 75.7% | 81% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 72.7% | 77.2% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 71.5% | 76.2% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 70.4% | 75.3% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 66% | 70.4% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 41.9% | 44% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1218
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gctgaagaag caggcattgg agacaccccc agcctggaag 241 acgaagctgc tggtcacgtg acccaagctc gcatggtcag taaaagcaaa gacgggactg 301 gaagcgatga caaaaaagcc aagggggctg atggtaaaac gaagatcgcc acaccgcggg 361 gagcagcccc tccaggccag aagggccagg ccaacgccac caggattcca gcaaaaaccc 421 cgcccgctcc aaagacacca cccagctctg gtgaacctcc aaaatcaggg gatcgcagcg 481 gctacagcag ccccggctcc ccaggcactc ccggcagccg ctcccgcacc ccgtcccttc 541 caaccccacc cacccgggag cccaagaagg tggcagtggt ccgtactcca cccaagtcgc 601 cgtcttccgc caagagccgc ctgcagacag cccccgtgcc catgccagac ctgaagaatg 661 tcaagtccaa gatcggctcc actgagaacc tgaagcacca gccgggaggc gggaaggtgc 721 agataattaa taagaagctg gatcttagca acgtccagtc caagtgtggc tcaaaggata 781 atatcaaaca cgtcctggga ggcggcagtg tgcaaatagt ctacaaacca gttgacctga 841 gcaaggtgac ctccaagtgt ggctcattag gcaacaTCCA TCATAAACCA GGAGGTGGCC 901 AGGTGGAAGT AAAATCTGAG AAGCTTGACT TCAAGGACAG AGTCCAGTCG AAGATTGGGT 961 CCCTGGACAA TATCACCCAC GTCCCTGGCG GAGGAAATAA AAAGATTGAA ACCCACAAGC 1021 TGACCTTCCG CGAGAACGCC AAAGCCAAGA CAGACCACGG GGCGGAGATC GTGTACAAGT 1081 CGCCAGTGGT GTCTGGGGAC ACGTCTCCAC GGCATCTCAG CAATGTCTCC TCCACCGGCA 1141 GCATCGACAT GGTAGACTCG CCCCAGCTCG CCACGCTAGC TGACGAGGTG TCTGCCTCCC 1201 TGGCCAAGCA GGGTTTGTGA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1261 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1321 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTCG ATTCCAATTC 1381 TGAGTTCTTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt