Construct: ORF TRCN0000489406
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019172.1_s317c1
- DNA Barcode:
- GTGTGACTTTTGTTAAGCCCGTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPR2 (4882)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489406
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | NM_003995.3 | 99.9% | 99.9% | 3141_3142insG |
| 2 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_005251478.3 | 99.6% | 99.6% | 1436_1444delGTCCTTACA;3150_3151insG |
| 3 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447557.1 | 95.1% | 95% | 2048_2206del;3300_3301insG |
| 4 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447556.1 | 94.8% | 94.7% | 1436_1444delGTCCTTACA;2057_2215del;3309_3310insG |
| 5 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447558.1 | 65% | 64.9% | (many diffs) |
| 6 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447561.1 | 55.2% | 55.2% | 0_1ins1404;1737_1738insG |
| 7 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447560.1 | 52.6% | 52.4% | 0_1ins1404;644_802del;1896_1897insG |
| 8 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447559.1 | 52.4% | 52.3% | (many diffs) |
| 9 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_173788.4 | 92.2% | 98.5% | (many diffs) |
| 10 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_001355466.1 | 89.8% | 96.1% | (many diffs) |
| 11 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | XR_390318.4 | 43.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 3219
- ORF length:
- 3144
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcg ctgccatcac ttctgctgtt ggtggcagcc ctggcaggtg 121 gggtgcgtcc tcccggggcg cggaacctga cgctggcggt ggtgctgcca gaacacaacc 181 tgagctatgc ctgggcctgg ccacgggtgg gacccgctgt ggcactagct gtggaggctc 241 tgggccgggc actgcccgtg gacctgcggt ttgtcagctc cgaactggaa ggcgcctgct 301 ctgagtacct ggcaccgctg agcgctgtgg acctcaagct gtaccatgac cccgacctgc 361 tgttaggtcc cggttgcgtg taccctgctg cctctgtggc ccgctttgcc tcccactggc 421 gccttcccct gctgactgcg ggtgctgtgg cctctggttt ttcggctaag aatgaccatt 481 atcgtaccct ggttcgcact ggcccctctg ctcccaagct gggtgagttt gtggtgacac 541 tacacgggca cttcaattgg actgcccgtg ctgccttgct gtacctggat gctcgcacag 601 atgaccggcc tcactacttc accatcgagg gcgtctttga ggccctgcag ggcagcaacc 661 tcagtgtgca gcaccaggtg tatgcccgag agccaggggg ccccgagcag gccacccact 721 tcatccgggc caacgggcgc attgtgtata tctgcggccc tctggagatg ctgcatgaga 781 tcctgcttca ggcccagagg gagaatctga ccaatgggga ttatgtcttc ttttacctgg 841 atgtctttgg ggagagtctc cgtgcaggcc ccacacgtgc tacaggccgg ccctggcagg 901 acaatcgcac ccgggaacag gcccaggccc tcagagaggc ctttcagact gtattggtga 961 tcacgtaccg agaaccccca aatcctgagt atcaggaatt ccagaatcgt ctgctgataa 1021 gagcccggga agactttggt gtggagctgg gcccttccct gatgaacctc atcgctggct 1081 gcttctatga tgggatcctg ctatatgctg aagtcctgaa tgagacaata caggaaggag 1141 gcacccggga ggatggactt cgaattgtgg aaaagatgca gggacgaaga tatcacggtg 1201 taactgggct ggttgtcatg gacaagaaca atgaccgaga gactgacttt gtcctctggg 1261 ccatgggaga cctggattct ggggactttc agcctgcagc ccactactcg ggagctgaga 1321 agcagatttg gtggacggga cggcctattc cctgggtgaa gggggctcct ccctcggaca 1381 atcccccctg tgcctttgac ttggacgacc catcctgtga taaaactcca ctttcaaccc 1441 tggcaattgt ggctctgggc acaggaatca ccttcatcat gtttggtgtt tccagcttcc 1501 taattttccg aaagctgatg ctggagaagg agctggctag catgttgtgg cgtattcgct 1561 gggaagaact gcagtttggc aactcagagc gttatcacaa aggtgcaggc agtcgcctca 1621 cactgtcgct gcggggatcc agttacggct cgctcatgac agcccatggg aaataccaga 1681 tctttgccaa caccggtcac ttcaagggaa atgttgtcgc catcaaacat gtgaataaga 1741 agcgcattga gctgacccgg caggttctgt ttgaactcaa acatatgaga gatgttcagt 1801 tcaaccatct cactcgcttc attggcgcct gcatagaccc tcccaacatt tgcattgtca 1861 ctgaatactg tcctcgtggg agtttacagg atattctaga aaatgacagc atcaacttgg 1921 actggatgtt tcgttattca ctcattaatg accttgttaa gggcatggcc tttctccaca 1981 acagcattat ttcatcgcat gggagtctca agtcctccaa ctgtgtggtg gatagtcgtt 2041 ttgtgctcaa aatcacagac tatggcctgg ccagcttccg atcaactgct gaacctgatg 2101 acagccatgc cctctatgcc aagaagctgt ggactgcccc agaactgctc agtgggaacc 2161 ccttgccaac cacaggcatg cagaaggctg acgtctatag ctttgggatc atcctgcagg 2221 agatagcact tcgcagtggt cctttctact tggagggcct ggacctcagc cccaaagaga 2281 ttgtccagaa ggtacgaaat ggtcagcggc catatttccg gccaagcatt gaccggaccc 2341 aactgaatga agagctagtt ttgctgatgg agcgatgttg ggctcaggac ccagctgagc 2401 ggccagactt tggacagatt aagggcttca ttcggcgctt taacaaggag ggtggcacca 2461 gcatattgga caacctcctg ctgcgcatgg aacagtatgc caataacttg gagaagctgg 2521 tggaggaacg cacacaggcc tatctggagg aaaaacgcaa ggctgaagct ctgctctacc 2581 aaatcctacc ccattcagtg gcagagcagt taaaacgggg agagactgta caggctgagg 2641 cctttgacag tgttaccatc tacttcagtg acattgttgg cttcacagca ttgtcagcag 2701 agagcacccc catgcaggta gtgacacttc ttaatgacct gtatacctgc tttgatgcca 2761 taattgacaa ctttgatgtc tacaaggtgg agacgattgg ggatgcttac atggtggtat 2821 ctggcctccc aggccgaaat ggtcaacgcc atgcaccaga aattgctcgt atggccctag 2881 cattactaga tgcagtttct tcctttcgca tccgccaccg accccatgac cagctgaggc 2941 tacgcatagg ggtccatact gggccagtct gtgctggggt tgttggcctg aagatgcccc 3001 gttattgtct ttttGGAGAC ACAGTGAACA CTGCTTCTCG AATGGAGTCT AATGGTCAAG 3061 CGCTGAAGAT CCATGTCTCC TCTACCACCA AGGATGCCCT AGATGAGCTA GGATGCTTCC 3121 AGCTAGAGCT TCGGGGGGAT GTGGAAATGA AGGGAAAAGG AAAGATGCGA ACATACTGGC 3181 TCTTAGGAGA GCGGAAAGGA CCTCCTGGAC TCCTGGACCC AGCTTTCTTG TACAAAGTGG 3241 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 3301 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 3361 AGTGTGACTT TTGTTAAGCC CGTAAACGCG TTAAGTCgac aatcaacctc tggattacaa 3421 aatttgtgaa agatt