Construct: ORF TRCN0000489412
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019660.1_s317c1
- DNA Barcode:
- GAGAACGCACGCGAGCTGTACATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAQR5 (54852)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489412
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_001104554.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 2 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_017705.4 | 99.7% | 99.3% | 71T>C;990_991insG |
| 3 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521720.2 | 99.7% | 99.3% | 71T>C;990_991insG |
| 4 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022360.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 5 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022361.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 6 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022362.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 7 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022363.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 8 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022364.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 9 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449966.1 | 99.7% | 99.3% | 71T>C;990_991insG |
| 10 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_005254495.4 | 95.3% | 94.5% | (many diffs) |
| 11 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521723.2 | 86.5% | 86.4% | 0_1ins132;858_859insG |
| 12 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449967.1 | 68.4% | 50.1% | (many diffs) |
| 13 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521725.2 | 66.1% | 65.8% | 71T>C;178_179ins333;657_658insG |
| 14 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022366.1 | 65% | 60.7% | 0_1ins139;39_40ins206;645_646insG |
| 15 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521727.2 | 64.3% | 60.4% | 71T>C;608_609ins142;639_640ins210 |
| 16 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022368.1 | 52.9% | 52.8% | 0_1ins132;46_47ins333;525_526insG |
| 17 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | NM_028748.2 | 88.1% | 90.9% | (many diffs) |
| 18 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511508.3 | 84.3% | 86.7% | (many diffs) |
| 19 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511509.2 | 70.5% | 72.2% | (many diffs) |
| 20 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511510.2 | 57.2% | 55.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1068
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgctg agcctgaagc tccccaggct gtttagcata gaccagatac 121 cccaggtgtt ccatgagcaa ggcaccctgt tcggctaccg ccatccacag agttctgcca 181 ctgcctgcat cctcagcctt ttccaaatga ccaatgagac tctcaacatt tggactcact 241 tgctgccctt ctggttcttt gcatggaggt ttgtgactgc actgtatatg acagacatca 301 agaatgacag ctactcctgg cccatgcttg tgtacatgtg caccagctgc gtgtacccac 361 ttgtgtccag ctgtgcgcac accttcagct ctatgtccaa gaatgcccgg cacatttgct 421 acttcctgga ctatggtgcc gtcaacctct tcagcctggg ctcagccatt gcctactctg 481 catacacgtt cccggatgcg ctcatgtgca ccactttcca tgactactac gtggccctgg 541 ctgtactgaa caccatcctc agcacaggcc tctcctgcta ctccaggttt cttgaaatcc 601 agaagcccag actctgtaag gtgattcgtg tcctcgcctt tgcttatccg tacacctggg 661 actccctccc catcttcTAC AGGCTATTCC TGTTCCCAGG GGAGAGTGCA CAAAATGAAG 721 CCACCTCGTA CCACCAGAAG CACATGATCA TGACCCTCCT GGCCTCTTTC TTGTACTCTG 781 CACATCTGCC AGAACGCCTA GCCCCTGGAC GCTTTGACTA CATCGGTCAC AGTCACCAGC 841 TGTTTCACGT GTGTGTGATC CTGGCCACGC ACATGCAGAT GGAAGCCATA CTTCTGGACA 901 AGACTCTGAG GAAGGAATGG CTCCTGGCCA CCTCCAAGCC CTTCTCTTTC TCTCAGATAG 961 CTGGAGCCAT ACTTCTGTGC ATCATCTTCA GCCTCAGCAA CATAATTTAT TTCTCAGCTG 1021 CTCTGTATCG GATTCCCAAG CCAGAATTAC ATAAAAAAGA AACAGACCCA GCTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1201 GAAAGGACGA GAGAACGCAC GCGAGCTGTA CATAACGCGT TAAGTCgaca atcaacctct 1261 ggattacaaa atttgtgaaa gatt