Construct: ORF TRCN0000489463
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020950.1_s317c1
- DNA Barcode:
- TGACGCTAGCAGGTGCGCATAAGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR82 (27197)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489463
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27197 | GPR82 | G protein-coupled receptor 82 | NM_080817.5 | 100% | 100% | |
| 2 | mouse | 319200 | Gpr82 | G protein-coupled receptor 82 | NM_175669.3 | 84% | 80.1% | (many diffs) |
| 3 | mouse | 319200 | Gpr82 | G protein-coupled receptor 82 | XM_011247475.1 | 84% | 80.1% | (many diffs) |
| 4 | mouse | 319200 | Gpr82 | G protein-coupled receptor 82 | XM_017318522.1 | 84% | 80.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1080
- ORF length:
- 1008
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaacaac aatacaacat gtattcaacc atctatgatc tcttccatgg 121 ctttaccaat catttacatc ctcctttgta ttgttggtgt ttttggaaac actctctctc 181 aatggatatt tttaacaaaa ataggtaaaa aaacatcaac gcacatctac ctgtcacacc 241 ttgtgactgc aaacttactt gtgtgcagtg ccatgccttt catgagtatc tatttcctga 301 aaggtttcca atgggaatat caatctgctc aatgcagagt ggtcaatttt ctgggaactc 361 tatccatgca tgcaagtatg tttgtcagtc tcttaatttt aagttggatt gccataagcc 421 gctatgctac cttaatgcaa aaggattcct cgcaagagac tacttcatgc tatgagaaaa 481 tattttatgg ccatttactg aaaaaatttc gccagcccaa ctttgctaga aaactatgca 541 tttacatatg gggagttgta ctgggcataa tcattccagt taccgtatac tactcagtca 601 tagaggctac agaaggagaa gagagcctat gctacaatcg gcagatggaa ctaggagcca 661 tgatctctca gattgcaggt ctcattggaa ccacatttat tGGATTTTCC TTTTTAGTAG 721 TACTAACATC ATACTACTCT TTTGTAAGCC ATCTGAGAAA AATAAGAACC TGTACGTCCA 781 TTATGGAGAA AGATTTGACT TACAGTTCTG TGAAAAGACA TCTTTTGGTC ATCCAGATTC 841 TACTAATAGT TTGCTTCCTT CCTTATAGTA TTTTTAAACC CATTTTTTAT GTTCTACACC 901 AAAGAGATAA CTGTCAGCAA TTGAATTATT TAATAGAAAC AAAAAACATT CTCACCTGTC 961 TTGCTTCGGC CAGAAGTAGC ACAGACCCCA TTATATTTCT TTTATTAGAT AAAACATTCA 1021 AGAAGACACT ATATAATCTC TTTACAAAGT CTAATTCAGC ACATATGCAA TCATATGGTT 1081 AGAACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1141 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1201 GGCTTTATAT ATCTTGTGGA AAGGACGATG ACGCTAGCAG GTGCGCATAA GTACGCGTTA 1261 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt