Transcript: Mouse NM_175669.3

Mus musculus G protein-coupled receptor 82 (Gpr82), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gpr82 (319200)
Length:
2497
CDS:
279..1265

Additional Resources:

NCBI RefSeq record:
NM_175669.3
NBCI Gene record:
Gpr82 (319200)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027826 CCGCTATGCTACCTTAATGAA pLKO.1 626 CDS 100% 5.625 7.875 N Gpr82 n/a
2 TRCN0000440773 GACTTACAGTTCTACTTATAT pLKO_005 1412 3UTR 100% 15.000 12.000 N Gpr82 n/a
3 TRCN0000450827 AGTAGTGACATCATACTATTC pLKO_005 926 CDS 100% 10.800 7.560 N Gpr82 n/a
4 TRCN0000454005 GACAGAGCCAGTGCTACAATC pLKO_005 826 CDS 100% 10.800 7.560 N Gpr82 n/a
5 TRCN0000027849 GCTATGCCTTTCATGGGTATA pLKO.1 477 CDS 100% 10.800 7.560 N Gpr82 n/a
6 TRCN0000027832 CCTCCATTACCGAGAAAGATT pLKO.1 982 CDS 100% 5.625 3.938 N Gpr82 n/a
7 TRCN0000027769 CCGTGATTTCTACCACAGCTT pLKO.1 310 CDS 100% 2.640 1.848 N Gpr82 n/a
8 TRCN0000027767 AGACACTATATGGTCTCCTTA pLKO.1 1234 CDS 100% 4.950 2.970 N Gpr82 n/a
9 TRCN0000357343 CATTCAAGAAGACACTATATA pLKO_005 1225 CDS 100% 15.000 10.500 N GPR82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489463 TGACGCTAGCAGGTGCGCATAAGT pLX_317 37.8% 84% 80.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488235 CGTGCCTCGTCCCGATTTAGCTAT pLX_317 37.5% 83.9% 79.8% V5 (many diffs) n/a
Download CSV