Transcript: Mouse XM_011247475.1

PREDICTED: Mus musculus G protein-coupled receptor 82 (Gpr82), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr82 (319200)
Length:
5452
CDS:
3542..4528

Additional Resources:

NCBI RefSeq record:
XM_011247475.1
NBCI Gene record:
Gpr82 (319200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027826 CCGCTATGCTACCTTAATGAA pLKO.1 3889 CDS 100% 5.625 7.875 N Gpr82 n/a
2 TRCN0000440773 GACTTACAGTTCTACTTATAT pLKO_005 4675 3UTR 100% 15.000 12.000 N Gpr82 n/a
3 TRCN0000450827 AGTAGTGACATCATACTATTC pLKO_005 4189 CDS 100% 10.800 7.560 N Gpr82 n/a
4 TRCN0000454005 GACAGAGCCAGTGCTACAATC pLKO_005 4089 CDS 100% 10.800 7.560 N Gpr82 n/a
5 TRCN0000027849 GCTATGCCTTTCATGGGTATA pLKO.1 3740 CDS 100% 10.800 7.560 N Gpr82 n/a
6 TRCN0000027832 CCTCCATTACCGAGAAAGATT pLKO.1 4245 CDS 100% 5.625 3.938 N Gpr82 n/a
7 TRCN0000027769 CCGTGATTTCTACCACAGCTT pLKO.1 3573 CDS 100% 2.640 1.848 N Gpr82 n/a
8 TRCN0000027767 AGACACTATATGGTCTCCTTA pLKO.1 4497 CDS 100% 4.950 2.970 N Gpr82 n/a
9 TRCN0000357343 CATTCAAGAAGACACTATATA pLKO_005 4488 CDS 100% 15.000 10.500 N GPR82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489463 TGACGCTAGCAGGTGCGCATAAGT pLX_317 37.8% 84% 80.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488235 CGTGCCTCGTCCCGATTTAGCTAT pLX_317 37.5% 83.9% 79.8% V5 (many diffs) n/a
Download CSV