Construct: ORF TRCN0000489478
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019636.1_s317c1
- DNA Barcode:
- CACGGAAAAAGCCGCCAGTGATGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NTRK3 (4916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489478
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_002530.4 | 99.9% | 100% | 678C>T |
| 2 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720543.4 | 99.9% | 100% | 678C>T |
| 3 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022240.1 | 99.9% | 100% | 678C>T |
| 4 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001243101.1 | 99% | 98.9% | 1204_1205ins24 |
| 5 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720544.4 | 98.9% | 98.9% | 678C>T;1204_1205ins24 |
| 6 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001012338.2 | 98.3% | 98.3% | 2133_2174del |
| 7 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022253.2 | 98.2% | 98.3% | 678C>T;2133_2174del |
| 8 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022254.2 | 97% | 97% | 678C>T;2134_2208del |
| 9 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022241.1 | 91.7% | 89.5% | (many diffs) |
| 10 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022242.2 | 88.5% | 84.5% | (many diffs) |
| 11 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022243.1 | 88% | 88.1% | 0_1ins294;384C>T |
| 12 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022244.2 | 88% | 88.1% | 0_1ins294;384C>T |
| 13 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022245.2 | 88% | 88.1% | 0_1ins294;384C>T |
| 14 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449933.1 | 87.1% | 87% | 0_1ins294;384C>T;910_911ins24 |
| 15 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720545.4 | 86.3% | 86.3% | (many diffs) |
| 16 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320135.1 | 74.5% | 74.4% | (many diffs) |
| 17 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001007156.2 | 71.1% | 65.4% | (many diffs) |
| 18 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521637.3 | 71.1% | 65.4% | (many diffs) |
| 19 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449934.1 | 71.1% | 65.4% | (many diffs) |
| 20 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022247.2 | 70.1% | 64.3% | (many diffs) |
| 21 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320134.1 | 67.2% | 64.7% | (many diffs) |
| 22 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022248.2 | 66.2% | 63.6% | (many diffs) |
| 23 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449935.1 | 65.8% | 64.2% | (many diffs) |
| 24 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720548.4 | 63.9% | 64% | 678C>T;1584_1585ins891 |
| 25 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449936.1 | 59.3% | 53.7% | (many diffs) |
| 26 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720549.4 | 59.1% | 55.1% | (many diffs) |
| 27 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720550.4 | 58.2% | 54% | (many diffs) |
| 28 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022250.2 | 56.9% | 56.7% | (many diffs) |
| 29 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521638.3 | 56.7% | 56.4% | (many diffs) |
| 30 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751293.2 | 52.9% | (many diffs) | |
| 31 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022251.2 | 52.6% | 51.7% | (many diffs) |
| 32 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_002957645.1 | 51.9% | (many diffs) | |
| 33 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022252.2 | 51.9% | 49.7% | (many diffs) |
| 34 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751292.2 | 15.2% | 1_643del;1321C>T;3119_16213del | |
| 35 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_008746.5 | 91% | 97.2% | (many diffs) |
| 36 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250817.2 | 89.5% | 95.5% | (many diffs) |
| 37 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540691.3 | 88.4% | 94.3% | (many diffs) |
| 38 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250816.2 | 86.9% | 92.8% | (many diffs) |
| 39 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_182809.2 | 64.1% | 62.5% | (many diffs) |
| 40 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540692.3 | 61.1% | 61.9% | (many diffs) |
| 41 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_017322023.1 | 59.9% | 61.6% | (many diffs) |
| 42 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785487.1 | 31.7% | (many diffs) | |
| 43 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785488.1 | 30.5% | (many diffs) | |
| 44 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882023.2 | 27% | (many diffs) | |
| 45 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882022.2 | 16.9% | (many diffs) | |
| 46 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785486.1 | 16.6% | (many diffs) | |
| 47 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882025.2 | 15.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 93
- ORF end:
- 2568
- ORF length:
- 2475
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccgaa ttccgatcgg agatggatgt ctctctttgc ccagccaagt 121 gtagtttctg gcggattttc ttgctgggaa gcgtctggct ggactatgtg ggctccgtgc 181 tggcttgccc tgcaaattgt gtctgcagca agactgagat caattgccgg cggccggacg 241 atgggaacct cttccccctc ctggaagggc aggattcagg gaacagcaat gggaacgcca 301 gtatcaacat cacggacatc tcaaggaata tcacttccat acacatagag aactggcgca 361 gtcttcacac gctcaacgcc gtggacatgg agctctacac cggacttcaa aagctgacca 421 tcaagaactc aggacttcgg agcattcagc ccagagcctt tgccaagaac ccccatttgc 481 gttatataaa cctgtcaagt aaccggctca ccacactctc gtggcagctc ttccagacgc 541 tgagtcttcg ggaattgcag ttggagcaga actttttcaa ctgcagctgt gacatccgct 601 ggatgcagct ctggcaggag cagggggagg ccaagctcaa cagccagaac ctctactgca 661 tcaacgctga tggctcccag cttcctctct tccgcatgaa catcagtcag tgtgaccttc 721 ctgagatcag cgtgagccac gtcaacctga ccgtacgaga gggtgacaat gctgttatca 781 cttgcaatgg ctctggatca ccccttcctg atgtggactg gatagtcact gggctgcagt 841 ccatcaacac tcaccagacc aatctgaact ggaccaatgt tcatgccatc aacttgacgc 901 tggtgaatgt gacgagtgag gacaatggct tcaccctgac gtgcattgca gagaacgtgg 961 tgggcatgag caatgccagt gttgccctca ctgtctacta tcccccacgt gtggtgagcc 1021 tggaggagcc tgagctgcgc ctggagcact gcatcgagtt tgtggtgcgt ggcaaccccc 1081 caccaacgct gcactggctg cacaatgggc agcctctgcg ggagtccaag atcatccatg 1141 tggaatacta ccaagaggga gagatttccg agggctgcct gctcttcaac aagcccaccc 1201 actacaacaa tggcaactat accctcattg ccaaaaaccc actgggcaca gccaaccaga 1261 ccatcaatgg ccacttcctc aaggagccct ttccagagag cacggataac tttatcttgt 1321 ttgacgaagt gagtcccaca cctcctatca ctgtgaccca caaaccagaa gaagacactt 1381 ttggggtatc catagcagtt ggacttgctg cttttgcctg tgtcctgttg gtggttctct 1441 tcgtcatgat caacaaatat ggtcgacggt ccaaatttgg aatgaagggt cccgtggctg 1501 tcatcagtgg tgaggaggac tcagccagcc cactgcacca catcaaccac ggcatcacca 1561 cgccctcgtc actggatgcc gggcccgaca ctgtggtcat tggcatgact cgcatccctg 1621 tcattgagaa cccccagtac ttccgtcagg gacacaactg ccacaagccg gacacgtatg 1681 tgcagcacat taagaggaga gacatcgtgc tgaagcgaga actgggtgag ggagcctttg 1741 gaaaggtctt cctggccgag tgctacaacc tcagcccgac caaggacaag atgcttgtgg 1801 ctgtgaaggc cctgaaggat cccaccctgg ctgcccggaa ggatttccag agggaggccg 1861 agctgctcac caacctgcag catgagcaca ttgtcaagtt ctatggagtg tgcggcgatg 1921 gggaccccct catcatggtc tttgaataca tgaagcatgg agacctgaat aagttcctca 1981 gggcccatgg gccagatgca atgatccttg tggatggaca gccacgccag gccaagggtg 2041 agctggggct ctcccaaatg ctccacattg ccagtcagat cgcctcgggt atggtgtacc 2101 tggcctccca gcactttgtg caccgagacc tggccaccag gaactgcctg gttggagcga 2161 atctgctagt gaagattggg gacTTCGGCA TGTCCAGAGA TGTCTACAGC ACGGATTATT 2221 ACAGGGTGGG AGGACACACC ATGCTCCCCA TTCGCTGGAT GCCTCCTGAA AGCATCATGT 2281 ACCGGAAGTT CACTACAGAG AGTGATGTAT GGAGCTTCGG GGTGATCCTC TGGGAGATCT 2341 TCACCTATGG AAAGCAGCCA TGGTTCCAAC TCTCAAACAC GGAGGTCATT GAGTGCATTA 2401 CCCAAGGTCG TGTTTTGGAG CGGCCCCGAG TCTGCCCCAA AGAGGTGTAC GATGTCATGC 2461 TGGGGTGCTG GCAGAGGGAA CCACAGCAGC GGTTGAACAT CAAGGAGATC TACAAAATCC 2521 TCCATGCTTT GGGGAAGGCC ACCCCAATCT ACCTGGACAT TCTTGGCAAG GGTGGGCGCG 2581 CCGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 2641 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 2701 GGCTTTATAT ATCTTGTGGA AAGGACGACA CGGAAAAAGC CGCCAGTGAT GGACGCGTTA 2761 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt