Construct: ORF TRCN0000489490
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020939.1_s317c1
- DNA Barcode:
- TTTTGACGCGAGCAACACGAGGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPSR1 (387129)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489490
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_207172.2 | 99.8% | 99.4% | 169T>C;723C>G |
| 2 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_207173.2 | 92.6% | 90.9% | (many diffs) |
| 3 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300933.2 | 89.8% | 88% | (many diffs) |
| 4 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300935.1 | 88% | 84.4% | (many diffs) |
| 5 | human | 387129 | NPSR1 | neuropeptide S receptor 1 | NM_001300934.1 | 82% | 81.6% | 169T>C;278_279ins198;525C>G |
| 6 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | NM_175678.3 | 86.6% | 88.6% | (many diffs) |
| 7 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | XM_017313417.1 | 86.6% | 88.6% | (many diffs) |
| 8 | mouse | 319239 | Npsr1 | neuropeptide S receptor 1 | XM_017313418.1 | 51.7% | 53.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1185
- ORF length:
- 1113
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccagcc aacttcacag agggcagctt cgattccagt gggaccgggc 121 agacgctgga ttcttcccca gtggcttgca ctgaaacagt gacttttact gaagtggtgg 181 aaggaaagga atggggttcc ttctactact cctttaagac tgagcaattg ataactctgc 241 gggtcctctt tgtttttacc attgttggaa actccgttgt gcttttttcc acatggagga 301 gaaagaagaa gtcaagaatg accttctttg tgactcagct ggccatcaca gattctttca 361 caggactggt caacatcttg acagatatta attggcgatt cactggagac ttcacggcac 421 ctgacctggt ttgccgagtg gtccgctatt tgcaggttgt gctgctctac gcctctacct 481 acgtcctggt gtccctcagc atagacagat accatgccat cgtctacccc atgaagttcc 541 ttcaaggaga aaagcaagcc agggtcctca ttgtgatcgc ctggagcctg tcttttctgt 601 tctccattcc caccctgatc atatttggga agaggacact gtccaacggt gaagtgcagt 661 gctgggccct gtggcctgac gactcctact ggaccccata catgaccatc gtggccttcc 721 tggtgtactt catccctctg acaatcatca gcatcatgta tggcattgtg atccgaacta 781 tttggattaa aaggaaaacc tacgaaacag tgatttccaa ctgctcagat gggaaactgt 841 gcagcagcta taaccgagga ctcatctcaa aggcaaaaat caaggctatc aagtatagca 901 tcatcatcat tcttgccttc atctgctgtt GGAGTCCATA CTTCCTGTTT GACATTTTGG 961 ACAATTTCAA CCTCCTTCCA GACACCCAGG AGCGTTTCTA TGCCTCTGTG ATCATTCAGA 1021 ACCTGCCAGC ATTGAATAGT GCCATCAACC CCCTCATCTA CTGTGTCTTC AGCAGCTCCA 1081 TCTCTTTCCC CTGCAGGGAG CAAAGATCAC AGGATTCCAG AATGACGTTC CGGGAGAGAA 1141 CTGAGAGGCA TGAGATGCAG ATTCTGTCCA AGCCAGAATT CATCTAGGAC CCAGCTTTCT 1201 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1261 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1321 GTGGAAAGGA CGATTTTGAC GCGAGCAACA CGAGGTCACG CGTTAAGTCg acaatcaacc 1381 tctggattac aaaatttgtg aaagatt