Construct: ORF TRCN0000489946
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021348.1_s317c1
- DNA Barcode:
- TAATTGCCAGGGTCGAAGCCGTTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- KCTD6 (200845)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489946
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200845 | KCTD6 | potassium channel tetrameri... | NM_001128214.2 | 96.2% | 96.2% | 1_27del |
| 2 | human | 200845 | KCTD6 | potassium channel tetrameri... | NM_153331.3 | 96.2% | 96.2% | 1_27del |
| 3 | human | 200845 | KCTD6 | potassium channel tetrameri... | XM_005264937.2 | 96.2% | 96.2% | 1_27del |
| 4 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_001305936.1 | 85% | 95.3% | (many diffs) |
| 5 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_001305937.1 | 85% | 95.3% | (many diffs) |
| 6 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | NM_027782.3 | 85% | 95.3% | (many diffs) |
| 7 | mouse | 71393 | Kctd6 | potassium channel tetrameri... | XM_006518105.3 | 85% | 95.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 756
- ORF length:
- 684
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgactgac ccagtcacat taaatgtagg tggacacttg tatacaacgt 121 ctctcaccac attgacgcgt tacccggatt ccatgcttgg agctatgttt gggggggact 181 tccccacagc tcgagaccct caaggcaatt actttattga tcgagatgga cctcttttcc 241 gatatgtcct caacttctta agaacttcag aattgacctt accgttggat tttaaggaat 301 ttgatctgct tcggaaagaa gcagattttt accagattga gcccttgatt cagtgtctca 361 atgatcctaa gcctttgtat cccatggata cttttgaaga agttgtggag ctgtctagta 421 ctcggaagct ttctaagtac tccaacccag tggctgtcat cataacgcaa ctaaccatca 481 ccacTAAGGT CCATTCCTTA CTAGAAGGCA TCTCAAATTA TTTTACCAAG TGGAATAAGC 541 ACATGATGGA CACCAGAGAC TGCCAGGTTT CCTTTACTTT TGGACCCTGT GATTATCACC 601 AGGAAGTTTC TCTTAGGGTC CACCTGATGG AATACATTAC AAAACAAGGT TTCACGATCC 661 GCAACACCCG GGTGCATCAC ATGAGTGAGC GGGCCAATGA AAACACAGTG GAGCACAACT 721 GGACTTTCTG TAGGCTAGCC CGGAAGACAG ACGACTAGAA CCCAGCTTTC TTGTACAAAG 781 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 841 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 901 ACGATAATTG CCAGGGTCGA AGCCGTTAAC GCGTTAAGTC gacaatcaac ctctggatta 961 caaaatttgt gaaagatt