Construct: ORF TRCN0000491255
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020695.2_s317c1
- DNA Barcode:
- TGAGGTATCTGACCGTTGGGTATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ADCK5 (203054)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491255
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 203054 | ADCK5 | aarF domain containing kina... | NM_174922.5 | 99.9% | 99.8% | 51C>A |
| 2 | human | 203054 | ADCK5 | aarF domain containing kina... | XM_011516907.3 | 88.5% | 88.3% | (many diffs) |
| 3 | human | 203054 | ADCK5 | aarF domain containing kina... | XM_011516909.1 | 88.4% | 88.4% | 0_1ins201 |
| 4 | human | 203054 | ADCK5 | aarF domain containing kina... | XM_017013174.1 | 88.4% | 88.4% | 0_1ins201 |
| 5 | human | 203054 | ADCK5 | aarF domain containing kina... | XR_002956603.1 | 82.8% | (many diffs) | |
| 6 | human | 203054 | ADCK5 | aarF domain containing kina... | XM_006716527.2 | 81.5% | 80.5% | 0_1ins316;24_25insAGAAC |
| 7 | human | 203054 | ADCK5 | aarF domain containing kina... | XM_011516910.1 | 81.5% | 80.5% | 0_1ins316;24_25insAGAAC |
| 8 | human | 203054 | ADCK5 | aarF domain containing kina... | XR_928305.3 | 64.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1812
- ORF length:
- 1740
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtggcga ccggtgcagc tctgtcattt ccactctgct ctgctgcaca 121 gaaggcagaa gccctggccg tcccctgctg tgttcttcag gagaaacgtc aggggccttc 181 ctccaaggtt ctccagcccc acacccctgt ggaggaaggt gctctccacc gcggtagtgg 241 gggcgcccct gctcctcgga gcccgctatg tcatggcaga ggcacgggag aagaggagga 301 tgcggctcgt ggtggatggc atggggcgct ttggcaggtc tctgaaggtc ggcctgcaga 361 tctccctgga ctactggtgg tgcaccaatg ttgtccttcg aggggtggaa gagaacagcc 421 caggctactt ggaggtgatg tctgcgtgtc accagcgggc ggctgatgcc ctggtggcag 481 gggccatcag caacgggggc ctctacgtga agctgggcca ggggctgtgc tccttcaacc 541 acctgcttcc ccccgagtat acccggaccc tgcgcgtgct agaggacagg gccctcaagc 601 ggggcttcca ggaggtggat gagttgttcc ttgaggactt ccaggccctc ccccacgagc 661 tcttccagga gtttgactac cagccaattg ctgccgccag cctggcacag gtgcacagag 721 ccaagctgca cgatggcacc agcgtggctg tgaaggtgca gtacatcgac ctgcgggacc 781 gctttgatgg ggacatccac accctggagc tcctgctgcg gctcgttgag gtcatgcacc 841 ccagctttgg cttcagctgg gtcctccagg acctgaaggg gaccctggcc caggagctgg 901 acttcgagaa tgagggccgc aacgcagagc gctgtgcgcg ggagctggcg cacttcccct 961 acgtcgtggt gccccgcgtg cactgggaca agtccagcaa gcgcgtgctc actgccgact 1021 tctgcgccgg ctgcaaggtc aacgatgtgg aggccatcag gagccagggg ctggcagtgc 1081 atgacatagc agaaaagctc atcaaggcct ttgctgagca gatattttac accggcttca 1141 tccactcgga cccacatcct ggcaacgttc tggtgcggaa aggcccggac gggaaagcgg 1201 agctggtgct gctggaccac gggctctacc agttcctgga ggagaaggac cgcgcagccc 1261 tctgccagct gtggcgggcc atcatcctgc gggacgacgc cgccatgagg gcgcacgcag 1321 ccgcactggg ggtgcaagac tacctcctgt tcgccgagat gctcatgcag cgccccgtgc 1381 gcctggggca gctgtggggc tcgcacctac tgagccgcga agaggcggcc tacatggtgg 1441 acatggcccg cgagcgcTTC GAGGCCGTCA TGGCGGTGCT CAGGGAGCTG CCGCGGCCCA 1501 TGCTGCTGGT GCTGCGCAAC ATCAACACCG TGCGCGCTAT CAACGTGGCC CTCGGCGCCC 1561 CCGTGGACCG CTACTTCCTT ATGGCTAAAA GGGCTGTCCG GGGCTGGAGC CGCCTGGCGG 1621 GCGCCACGTA TCGGGGTGTC TACGGCACCA GCCTCCTGCG CCACGCCAAG GTCGTCTGGG 1681 AGATGCTCAA GTTTGAAGTG GCGCTCAGGC TGGAGACCTT GGCCATGCGG CTGACCGCCC 1741 TCCTGGCTCG TGCTCTGGTC CACCTGAGCC TCGTGCCCCC AGCGGAGGAG CTCTACCAGT 1801 ACCTGGAGAC CTAGAACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1861 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1921 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TGAGGTATCT GACCGTTGGG 1981 TATTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt