Transcript: Human XM_011516910.1

PREDICTED: Homo sapiens aarF domain containing kinase 5 (ADCK5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCK5 (203054)
Length:
2015
CDS:
426..1847

Additional Resources:

NCBI RefSeq record:
XM_011516910.1
NBCI Gene record:
ADCK5 (203054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162224 TGCCAGGATGTGGGTCCGAG pXPR_003 TGG 755 53% 9 -0.0150 ADCK5 ADCK5 77317
2 BRDN0001144876 CACCCCTCGAAGGACAACAT pXPR_003 TGG 3 0% 3 -0.1162 ADCK5 ADCK5 77318
3 BRDN0001145727 CGCGGGGCACCACGACGTAG pXPR_003 GGG 569 40% 7 -0.1227 ADCK5 ADCK5 77319
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232035 CGCTACTTCCTTATGGCTAAA pLKO_005 1602 CDS 100% 10.800 15.120 N ADCK5 n/a
2 TRCN0000021481 CCGCTACTTCCTTATGGCTAA pLKO.1 1601 CDS 100% 4.050 5.670 N ADCK5 n/a
3 TRCN0000021480 GCAGTGCATGACATAGCAGAA pLKO.1 1107 CDS 100% 4.050 5.670 N ADCK5 n/a
4 TRCN0000199526 GCCCGCTATGTCATGGCAGAG pLKO.1 225 5UTR 100% 0.000 0.000 N ADCK5 n/a
5 TRCN0000021482 GCCTTTGCTGAGCAGATATTT pLKO.1 1140 CDS 100% 15.000 10.500 N ADCK5 n/a
6 TRCN0000232034 GCCTTTGCTGAGCAGATATTT pLKO_005 1140 CDS 100% 15.000 10.500 N ADCK5 n/a
7 TRCN0000232032 ACGAGCTCTTCCAGGAGTTTG pLKO_005 688 CDS 100% 10.800 7.560 N ADCK5 n/a
8 TRCN0000232033 AGGAGCTGGACTTCGAGAATG pLKO_005 925 CDS 100% 10.800 7.560 N ADCK5 n/a
9 TRCN0000021483 GAGTTTGACTACCAGCCAATT pLKO.1 702 CDS 100% 10.800 7.560 N ADCK5 n/a
10 TRCN0000232036 TCTGGGAGATGCTCAAGTTTG pLKO_005 1708 CDS 100% 10.800 7.560 N ADCK5 n/a
11 TRCN0000199091 CTACTGGTGGTGCACCAATGT pLKO.1 409 5UTR 100% 4.950 3.465 N ADCK5 n/a
12 TRCN0000197074 GTTCTTCAGGAGAAACGTCAG pLKO.1 116 5UTR 100% 2.250 1.575 N ADCK5 n/a
13 TRCN0000021479 CGGCGGGGCCCTTTTCACCTT pLKO.1 1866 3UTR 100% 0.000 0.000 N ADCK5 n/a
14 TRCN0000199602 GCTCGTGCTCTGGTCCACCTG pLKO.1 1779 CDS 100% 0.000 0.000 N ADCK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491255 TGAGGTATCTGACCGTTGGGTATT pLX_317 20.8% 81.5% 80.5% V5 (not translated due to prior stop codon) 0_1ins316;24_25insAGAAC n/a
2 ccsbBroadEn_13396 pDONR223 100% 35.7% 35.7% None 1_912del n/a
3 ccsbBroad304_13396 pLX_304 0% 35.7% 35.7% V5 1_912del n/a
4 TRCN0000491790 TCGAAGAATGATTGTGTCCGACAA pLX_317 34.5% 35.7% 35.7% V5 1_912del n/a
Download CSV