Transcript: Human XM_017013174.1

PREDICTED: Homo sapiens aarF domain containing kinase 5 (ADCK5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCK5 (203054)
Length:
2030
CDS:
321..1862

Additional Resources:

NCBI RefSeq record:
XM_017013174.1
NBCI Gene record:
ADCK5 (203054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232035 CGCTACTTCCTTATGGCTAAA pLKO_005 1617 CDS 100% 10.800 15.120 N ADCK5 n/a
2 TRCN0000021481 CCGCTACTTCCTTATGGCTAA pLKO.1 1616 CDS 100% 4.050 5.670 N ADCK5 n/a
3 TRCN0000021480 GCAGTGCATGACATAGCAGAA pLKO.1 1122 CDS 100% 4.050 5.670 N ADCK5 n/a
4 TRCN0000199526 GCCCGCTATGTCATGGCAGAG pLKO.1 309 5UTR 100% 0.000 0.000 N ADCK5 n/a
5 TRCN0000021482 GCCTTTGCTGAGCAGATATTT pLKO.1 1155 CDS 100% 15.000 10.500 N ADCK5 n/a
6 TRCN0000232034 GCCTTTGCTGAGCAGATATTT pLKO_005 1155 CDS 100% 15.000 10.500 N ADCK5 n/a
7 TRCN0000232032 ACGAGCTCTTCCAGGAGTTTG pLKO_005 703 CDS 100% 10.800 7.560 N ADCK5 n/a
8 TRCN0000232033 AGGAGCTGGACTTCGAGAATG pLKO_005 940 CDS 100% 10.800 7.560 N ADCK5 n/a
9 TRCN0000021483 GAGTTTGACTACCAGCCAATT pLKO.1 717 CDS 100% 10.800 7.560 N ADCK5 n/a
10 TRCN0000232036 TCTGGGAGATGCTCAAGTTTG pLKO_005 1723 CDS 100% 10.800 7.560 N ADCK5 n/a
11 TRCN0000199091 CTACTGGTGGTGCACCAATGT pLKO.1 419 CDS 100% 4.950 3.465 N ADCK5 n/a
12 TRCN0000197074 GTTCTTCAGGAGAAACGTCAG pLKO.1 200 5UTR 100% 2.250 1.575 N ADCK5 n/a
13 TRCN0000021479 CGGCGGGGCCCTTTTCACCTT pLKO.1 1881 3UTR 100% 0.000 0.000 N ADCK5 n/a
14 TRCN0000199602 GCTCGTGCTCTGGTCCACCTG pLKO.1 1794 CDS 100% 0.000 0.000 N ADCK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491255 TGAGGTATCTGACCGTTGGGTATT pLX_317 20.8% 88.4% 88.4% V5 (not translated due to prior stop codon) 0_1ins201 n/a
2 ccsbBroadEn_13396 pDONR223 100% 32.9% 32.9% None 1_1032del n/a
3 ccsbBroad304_13396 pLX_304 0% 32.9% 32.9% V5 1_1032del n/a
4 TRCN0000491790 TCGAAGAATGATTGTGTCCGACAA pLX_317 34.5% 32.9% 32.9% V5 1_1032del n/a
Download CSV