Construct: ORF TRCN0000491256
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021251.2_s317c1
- DNA Barcode:
- CAAGGCAACGTGCGGTCTTAGTGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GRAP2 (9402)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491256
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | NM_001291824.2 | 100% | 100% | |
| 2 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | NM_001291825.1 | 100% | 100% | |
| 3 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | NM_004810.4 | 100% | 100% | |
| 4 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | NM_001291826.2 | 78.1% | 78.1% | 0_1ins216 |
| 5 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | XM_006724376.3 | 78.1% | 78.1% | 0_1ins216 |
| 6 | human | 9402 | GRAP2 | GRB2 related adaptor protein 2 | NM_001291828.2 | 65.7% | 56.6% | 0_1ins170;117_118ins169 |
| 7 | mouse | 17444 | Grap2 | GRB2-related adaptor protein 2 | NM_001289442.1 | 81.8% | 86% | (many diffs) |
| 8 | mouse | 17444 | Grap2 | GRB2-related adaptor protein 2 | NM_010815.3 | 81.8% | 86% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1062
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaagct gttgccaagt ttgatttcac tgcttcaggt gaggatgaac 121 tgagctttca cactggagat gttttgaaga ttttaagtaa ccaagaggag tggtttaagg 181 cggagcttgg gagccaggaa ggatatgtgc ccaagaattt catagacatc cagtttccca 241 aatggtttca cgaaggcctc tctcgacacc aggcagagaa cttactcatg ggcaaggagg 301 ttggcttctt catcatccgg gccagccaga gctccccagg ggacttctcc atctctgtca 361 ggcatgagga tgacgttcaa cacttcaagg tcatgcgaga caacaagggt aattactttc 421 tgtggactga gaagtttcca tccctaaata agctggtaga ctactacagg acaaattcca 481 tctccagaca gaagcagatc ttccttagag acagaacccg agaagaccag ggtcaccggg 541 gcaacagcct ggaccggagg tcccagggag gcccacacct cagtggggct gtgggagaag 601 aaatccgacc ttcgatgaac cggaagctgt cggatcaccc cccgaccctt cccctgcagc 661 agcaccagca ccagccacag cctccgcaat atgccccagc gccccagcag ctgcagcagc 721 ccccacagca gcgatatctg cagcaccacc atttccacca ggaacgccga ggaggcagcc 781 ttgacataaa tgatgggcat tgtggcaccg gcttgggcag tgaaatgaat gcggcccTCA 841 TGCATCGGAG ACACACAGAC CCAGTGCAGC TCCAGGCGGC AGGGCGAGTG CGGTGGGCCC 901 GGGCGCTGTA TGACTTTGAG GCCCTGGAGG ATGACGAGCT GGGGTTCCAC AGCGGGGAGG 961 TGGTGGAGGT CCTGGATAGC TCCAACCCAT CCTGGTGGAC CGGCCGCCTG CACAACAAGC 1021 TGGGCCTCTT CCCTGCCAAC TACGTGGCAC CCATGACCCG ATAGAACCCA GCTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1201 GAAAGGACGA CAAGGCAACG TGCGGTCTTA GTGCACGCGT TAAGTCgaca atcaacctct 1261 ggattacaaa atttgtgaaa gatt