Transcript: Human NM_001291825.1

Homo sapiens GRB2 related adaptor protein 2 (GRAP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
GRAP2 (9402)
Length:
3541
CDS:
291..1283

Additional Resources:

NCBI RefSeq record:
NM_001291825.1
NBCI Gene record:
GRAP2 (9402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107178 CCTAAATAAGCTGGTAGACTA pLKO.1 662 CDS 100% 4.950 6.930 N GRAP2 n/a
2 TRCN0000107177 CGTTCAACACTTCAAGGTCAT pLKO.1 593 CDS 100% 4.050 5.670 N GRAP2 n/a
3 TRCN0000431125 GGAGGCAGCCTTGACATAAAT pLKO_005 990 CDS 100% 15.000 12.000 N GRAP2 n/a
4 TRCN0000417452 ATGTGCCCAAGAATTTCATAG pLKO_005 424 CDS 100% 10.800 8.640 N GRAP2 n/a
5 TRCN0000107176 GCGAGACAACAAGGGTAATTA pLKO.1 614 CDS 100% 15.000 10.500 N GRAP2 n/a
6 TRCN0000107179 GCTTTCACACTGGAGATGTTT pLKO.1 343 CDS 100% 5.625 3.938 N GRAP2 n/a
7 TRCN0000107175 GCCTGTGTACACACACAACTT pLKO.1 1390 3UTR 100% 0.495 0.347 N GRAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02155 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02155 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467032 AATGGGATCCGGTGGTTCCAGCAG pLX_317 32% 100% 100% V5 n/a
4 TRCN0000491256 CAAGGCAACGTGCGGTCTTAGTGC pLX_317 23.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV