Transcript: Human NM_001291828.2

Homo sapiens GRB2 related adaptor protein 2 (GRAP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GRAP2 (9402)
Length:
3541
CDS:
251..904

Additional Resources:

NCBI RefSeq record:
NM_001291828.2
NBCI Gene record:
GRAP2 (9402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431125 GGAGGCAGCCTTGACATAAAT pLKO_005 611 CDS 100% 15.000 12.000 N GRAP2 n/a
2 TRCN0000107175 GCCTGTGTACACACACAACTT pLKO.1 1011 3UTR 100% 0.495 0.347 N GRAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02155 pDONR223 100% 65.7% 56.6% None 0_1ins170;117_118ins169 n/a
2 ccsbBroad304_02155 pLX_304 0% 65.7% 56.6% V5 0_1ins170;117_118ins169 n/a
3 TRCN0000467032 AATGGGATCCGGTGGTTCCAGCAG pLX_317 32% 65.7% 56.6% V5 0_1ins170;117_118ins169 n/a
4 TRCN0000491256 CAAGGCAACGTGCGGTCTTAGTGC pLX_317 23.3% 65.7% 56.6% V5 (not translated due to prior stop codon) 0_1ins170;117_118ins169 n/a
Download CSV