Transcript: Mouse NM_001289442.1

Mus musculus GRB2-related adaptor protein 2 (Grap2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Grap2 (17444)
Length:
5380
CDS:
160..1128

Additional Resources:

NCBI RefSeq record:
NM_001289442.1
NBCI Gene record:
Grap2 (17444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097104 CGCCCTGAGAATTAAGGTGTA pLKO.1 1628 3UTR 100% 4.050 5.670 N Grap2 n/a
2 TRCN0000097105 CCGAGAAGTTCCCATCCTTAA pLKO.1 515 CDS 100% 10.800 8.640 N Grap2 n/a
3 TRCN0000097106 GCACAACAAACTGGGTCTCTT pLKO.1 1074 CDS 100% 4.950 3.960 N Grap2 n/a
4 TRCN0000097107 CGAGAAGTTCCCATCCTTAAA pLKO.1 516 CDS 100% 13.200 9.240 N Grap2 n/a
5 TRCN0000097108 GCCAAGAAGGATATGTGCCTA pLKO.1 281 CDS 100% 2.640 1.848 N Grap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02155 pDONR223 100% 81.8% 86% None (many diffs) n/a
2 ccsbBroad304_02155 pLX_304 0% 81.8% 86% V5 (many diffs) n/a
3 TRCN0000467032 AATGGGATCCGGTGGTTCCAGCAG pLX_317 32% 81.8% 86% V5 (many diffs) n/a
4 TRCN0000491256 CAAGGCAACGTGCGGTCTTAGTGC pLX_317 23.3% 81.8% 86% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV