Construct: ORF TRCN0000491267
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021541.2_s317c1
- DNA Barcode:
- GAGAAACATCTACGTGGCTCGGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PGRMC2 (10424)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491267
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10424 | PGRMC2 | progesterone receptor membr... | NM_006320.6 | 100% | 100% | |
| 2 | human | 10424 | PGRMC2 | progesterone receptor membr... | XM_011531533.2 | 68.8% | 55.3% | (many diffs) |
| 3 | mouse | 70804 | Pgrmc2 | progesterone receptor membr... | NM_027558.1 | 86.1% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 741
- ORF length:
- 669
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcggct ggtgatgggg acgtgaagct aggcaccctg gggagtggca 121 gcgagagcag caacgacggc ggcagcgaga gtccaggcga cgcgggagcg gcagcggaag 181 ggggaggctg ggcggcggcg gcgttggcgc ttctgacggg gggcggggaa atgctgctga 241 acgtggcgct ggtggctctg gtgctgctgg gggcctaccg gctgtgggtg cgctgggggc 301 ggcggggtct gggggccggg gccggggcgg gcgaggagag ccccgccacc tctctgcctc 361 gcatgaagaa gcgggacttc agcttggagc agctgcgcca gtacgacggc tcccgcaacc 421 cgcgcatcct gctcgcggtc aatgggaaag tcttcgacgt gaccaaaggc agcaagttct 481 acggcccggc gggtccatat ggaatatttg ctggtaggga tgcctccaga ggactggcca 541 cattttgcct agataaagat gcacttagag atgaatatga tgatctctca gatttgaatg 601 CAGTACAAAT GGAGAGTGTT CGAGAATGGG AAATGCAGTT TAAAGAAAAA TATGATTATG 661 TAGGCAGACT CCTAAAACCA GGAGAAGAAC CATCAGAATA TACAGATGAA GAAGATACCA 721 AGGATCACAA TAAACAGGAT TAGAACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG AGAAACATCT 901 ACGTGGCTCG GGCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att