Transcript: Human NM_006320.6

Homo sapiens progesterone receptor membrane component 2 (PGRMC2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PGRMC2 (10424)
Length:
2769
CDS:
24..695

Additional Resources:

NCBI RefSeq record:
NM_006320.6
NBCI Gene record:
PGRMC2 (10424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006320.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061302 CGCGGTCAATGGGAAAGTCTT pLKO.1 386 CDS 100% 4.950 6.930 N PGRMC2 n/a
2 TRCN0000061301 GCGGGTCCATATGGAATATTT pLKO.1 441 CDS 100% 0.000 0.000 N PGRMC2 n/a
3 TRCN0000413216 AGCAAGAAAGTCACAATATTA pLKO_005 954 3UTR 100% 15.000 10.500 N PGRMC2 n/a
4 TRCN0000342206 GATGCACTTAGAGATGAATAT pLKO_005 510 CDS 100% 13.200 9.240 N Pgrmc2 n/a
5 TRCN0000342156 TTATGTAGGCAGACTCCTAAA pLKO_005 608 CDS 100% 10.800 7.560 N Pgrmc2 n/a
6 TRCN0000061299 CAGATTTGAATGCAGTACAAA pLKO.1 541 CDS 100% 5.625 3.938 N PGRMC2 n/a
7 TRCN0000061298 GCACTTAGAGATGAATATGAT pLKO.1 513 CDS 100% 5.625 3.938 N PGRMC2 n/a
8 TRCN0000061300 AGGATCACAATAAACAGGATT pLKO.1 673 CDS 100% 4.950 3.465 N PGRMC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006320.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14045 pDONR223 97.3% 100% 100% None n/a
2 ccsbBroad304_14045 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467132 TCTCCGCAAGCTAGCCTTGTTAAG pLX_317 61.5% 100% 100% V5 n/a
4 TRCN0000491267 GAGAAACATCTACGTGGCTCGGGC pLX_317 22% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488587 CCTATCTCTCAAGGTTAGGGACAA pLX_317 52.6% 99.8% 99.5% V5 669_670insG n/a
Download CSV