Transcript: Mouse NM_027558.1

Mus musculus progesterone receptor membrane component 2 (Pgrmc2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pgrmc2 (70804)
Length:
3022
CDS:
53..706

Additional Resources:

NCBI RefSeq record:
NM_027558.1
NBCI Gene record:
Pgrmc2 (70804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342207 AGACAACCAGATAGGTATTTG pLKO_005 1077 3UTR 100% 13.200 18.480 N Pgrmc2 n/a
2 TRCN0000342157 GGCGACATTCTGCCTGGATAA pLKO_005 499 CDS 100% 10.800 15.120 N Pgrmc2 n/a
3 TRCN0000342156 TTATGTAGGCAGACTCCTAAA pLKO_005 619 CDS 100% 10.800 8.640 N Pgrmc2 n/a
4 TRCN0000061302 CGCGGTCAATGGGAAAGTCTT pLKO.1 397 CDS 100% 4.950 3.960 N PGRMC2 n/a
5 TRCN0000342154 GACACCAAGGATCACAGTAAA pLKO_005 677 CDS 100% 13.200 9.240 N Pgrmc2 n/a
6 TRCN0000342206 GATGCACTTAGAGATGAATAT pLKO_005 521 CDS 100% 13.200 9.240 N Pgrmc2 n/a
7 TRCN0000061298 GCACTTAGAGATGAATATGAT pLKO.1 524 CDS 100% 5.625 3.938 N PGRMC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14045 pDONR223 97.3% 86.1% 87.8% None (many diffs) n/a
2 ccsbBroad304_14045 pLX_304 0% 86.1% 87.8% V5 (many diffs) n/a
3 TRCN0000467132 TCTCCGCAAGCTAGCCTTGTTAAG pLX_317 61.5% 86.1% 87.8% V5 (many diffs) n/a
4 TRCN0000491267 GAGAAACATCTACGTGGCTCGGGC pLX_317 22% 86.1% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488587 CCTATCTCTCAAGGTTAGGGACAA pLX_317 52.6% 86% 87.5% V5 (many diffs) n/a
Download CSV