Transcript: Human XM_011531533.2

PREDICTED: Homo sapiens progesterone receptor membrane component 2 (PGRMC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGRMC2 (10424)
Length:
1192
CDS:
344..997

Additional Resources:

NCBI RefSeq record:
XM_011531533.2
NBCI Gene record:
PGRMC2 (10424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061302 CGCGGTCAATGGGAAAGTCTT pLKO.1 778 CDS 100% 4.950 6.930 N PGRMC2 n/a
2 TRCN0000061301 GCGGGTCCATATGGAATATTT pLKO.1 1036 3UTR 100% 0.000 0.000 N PGRMC2 n/a
3 TRCN0000342206 GATGCACTTAGAGATGAATAT pLKO_005 1105 3UTR 100% 13.200 9.240 N Pgrmc2 n/a
4 TRCN0000061299 CAGATTTGAATGCAGTACAAA pLKO.1 1136 3UTR 100% 5.625 3.938 N PGRMC2 n/a
5 TRCN0000061298 GCACTTAGAGATGAATATGAT pLKO.1 1108 3UTR 100% 5.625 3.938 N PGRMC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14045 pDONR223 97.3% 68.8% 55.3% None (many diffs) n/a
2 ccsbBroad304_14045 pLX_304 0% 68.8% 55.3% V5 (many diffs) n/a
3 TRCN0000467132 TCTCCGCAAGCTAGCCTTGTTAAG pLX_317 61.5% 68.8% 55.3% V5 (many diffs) n/a
4 TRCN0000491267 GAGAAACATCTACGTGGCTCGGGC pLX_317 22% 68.8% 55.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488587 CCTATCTCTCAAGGTTAGGGACAA pLX_317 52.6% 68.7% 55.1% V5 (many diffs) n/a
Download CSV