Construct: ORF TRCN0000491289
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015625.2_s317c1
- Derived from:
- ccsbBroadEn_15764
- DNA Barcode:
- CACAACGAAAACCTGGGTGGACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPL13A (23521)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491289
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23521 | RPL13A | ribosomal protein L13a | NM_012423.4 | 99.8% | 100% | 387G>T |
| 2 | human | 728658 | RPL13AP5 | ribosomal protein L13a pseu... | NR_026712.1 | 91.9% | (many diffs) | |
| 3 | human | 644511 | RPL13AP6 | ribosomal protein L13a pseu... | NR_026715.1 | 89.1% | (many diffs) | |
| 4 | human | 387841 | RPL13AP20 | ribosomal protein L13a pseu... | NR_003932.2 | 89% | (many diffs) | |
| 5 | human | 23521 | RPL13A | ribosomal protein L13a | NM_001270491.1 | 69.7% | 69.9% | 0_1ins183;204G>T |
| 6 | human | 23521 | RPL13A | ribosomal protein L13a | NR_073024.1 | 50% | (many diffs) | |
| 7 | human | 645683 | RPL13AP3 | ribosomal protein L13a pseu... | NR_004844.1 | 32.2% | (many diffs) | |
| 8 | mouse | 22121 | Rpl13a | ribosomal protein L13A | NM_009438.5 | 88% | 95.5% | (many diffs) |
| 9 | mouse | 100504632 | Gm11478 | predicted gene 11478; 60S r... | XR_141061.5 | 77.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 675
- ORF length:
- 609
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggaggtgcag gtcctggtgc ttgatggtcg aggccatctc ctgggccgcc 121 tggcggccat cgtggctaaa caggtactgc tgggccggaa ggtggtggtc gtacgctgtg 181 aaggcatcaa catttctggc aatttctaca gaaacaagtt gaagtacctg gctttcctcc 241 gcaagcggat gaacaccaac ccttcccgag gcccctacca cttccgggcc cccagccgca 301 tcttctggcg gaccgtgcga ggtatgctgc cccacaaaac caagcgaggc caggccgctc 361 tggaccgtct caaggtgttt gacggcatcc caccgcccTA CGACAAGAAA AAGCGGATGG 421 TGGTTCCTGC TGCCCTCAAG GTCGTGCGTC TTAAGCCTAC AAGAAAGTTT GCCTATCTGG 481 GGCGCCTGGC TCACGAGGTT GGCTGGAAGT ACCAGGCAGT GACAGCCACC CTGGAGGAGA 541 AGAGGAAAGA GAAAGCCAAG ATCCACTACC GGAAGAAGAA ACAGCTCATG AGGCTACGGA 601 AACAGGCCGA GAAGAACGTG GAGAAGAAAA TTGACAAATA CACAGAGGTC CTCAAGACCC 661 ACGGACTCCT GGTCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 721 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 781 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CACAACGAAA ACCTGGGTGG 841 ACTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt