Transcript: Mouse XR_141061.5

PREDICTED: Mus musculus predicted gene 11478 (Gm11478), misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gm11478 (100504632)
Length:
681
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_141061.5
NBCI Gene record:
Gm11478 (100504632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_141061.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104517 GCCTACCAGAAAGTTTGCTTA pLKO.1 427 3UTR 100% 4.950 2.475 Y Rpl13a n/a
2 TRCN0000287371 GCCTACCAGAAAGTTTGCTTA pLKO_005 427 3UTR 100% 4.950 2.475 Y Rpl13a n/a
3 TRCN0000307437 TACGCTGTGAAGGCATCAACA pLKO_005 145 3UTR 100% 4.950 2.475 Y Rpl13a n/a
4 TRCN0000104516 CAAGTTAAAGTATCTGGCCTT pLKO.1 188 3UTR 100% 2.160 1.080 Y Rpl13a n/a
5 TRCN0000104518 GAGCGCCTCAAGGTGTTGGAT pLKO.1 335 3UTR 100% 1.000 0.500 Y Rpl13a n/a
6 TRCN0000287372 GAGCGCCTCAAGGTGTTGGAT pLKO_005 335 3UTR 100% 1.000 0.500 Y Rpl13a n/a
7 TRCN0000104515 CCCAATAAAGACTGTTTGCCT pLKO.1 651 3UTR 100% 0.750 0.375 Y Rpl13a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_141061.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07895 pDONR223 100% 78% None (many diffs) n/a
2 ccsbBroad304_07895 pLX_304 0% 78% V5 (many diffs) n/a
3 TRCN0000471523 CTACGTGCCCCGATATGGCGCTGG pLX_317 45.6% 78% V5 (many diffs) n/a
4 ccsbBroadEn_02785 pDONR223 100% 77.8% None (many diffs) n/a
5 ccsbBroad304_02785 pLX_304 0% 77.8% V5 (many diffs) n/a
6 TRCN0000475232 TTTGACACCCTGAAGGCCGTTTAT pLX_317 72.9% 77.8% V5 (many diffs) n/a
7 ccsbBroadEn_15764 pDONR223 0% 77.7% None (many diffs) n/a
8 ccsbBroad304_15764 pLX_304 0% 77.7% V5 (many diffs) n/a
9 TRCN0000491289 CACAACGAAAACCTGGGTGGACTC pLX_317 45.6% 77.7% V5 (many diffs) n/a
Download CSV