Transcript: Human NR_026712.1

Homo sapiens ribosomal protein L13a pseudogene 5 (RPL13AP5), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RPL13AP5 (728658)
Length:
658
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026712.1
NBCI Gene record:
RPL13AP5 (728658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117717 GCCCAATAAAGACTGTTAATT pLKO.1 635 3UTR 100% 15.000 7.500 Y RPL13A n/a
2 TRCN0000117721 CATCAACATTTCTGGCAATTT pLKO.1 142 3UTR 100% 13.200 6.600 Y RPL13A n/a
3 TRCN0000117718 GCATCAACATTTCTGGCAATT pLKO.1 141 3UTR 100% 10.800 5.400 Y RPL13A n/a
4 TRCN0000147525 GCATCAACATTTCTGGCAATT pLKO.1 141 3UTR 100% 10.800 5.400 Y RPL13AP17 n/a
5 TRCN0000307437 TACGCTGTGAAGGCATCAACA pLKO_005 129 3UTR 100% 4.950 2.475 Y Rpl13a n/a
6 TRCN0000117720 CCGGAAGAAGAAACAGCTCAT pLKO.1 526 3UTR 100% 4.050 2.025 Y RPL13A n/a
7 TRCN0000117719 CCTACAAGAAAGTTTGCCTAT pLKO.1 413 3UTR 100% 4.050 2.025 Y RPL13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02785 pDONR223 100% 92% None (many diffs) n/a
2 ccsbBroad304_02785 pLX_304 0% 92% V5 (many diffs) n/a
3 TRCN0000475232 TTTGACACCCTGAAGGCCGTTTAT pLX_317 72.9% 92% V5 (many diffs) n/a
4 ccsbBroadEn_07895 pDONR223 100% 91.9% None (many diffs) n/a
5 ccsbBroad304_07895 pLX_304 0% 91.9% V5 (many diffs) n/a
6 TRCN0000471523 CTACGTGCCCCGATATGGCGCTGG pLX_317 45.6% 91.9% V5 (many diffs) n/a
7 ccsbBroadEn_15764 pDONR223 0% 91.9% None (many diffs) n/a
8 ccsbBroad304_15764 pLX_304 0% 91.9% V5 (many diffs) n/a
9 TRCN0000491289 CACAACGAAAACCTGGGTGGACTC pLX_317 45.6% 91.9% V5 (many diffs) n/a
10 ccsbBroadEn_10402 pDONR223 100% 44% None (many diffs) n/a
11 ccsbBroad304_10402 pLX_304 0% 44% V5 (many diffs) n/a
12 TRCN0000469171 AAATCACCTGGGAAAGCCTAACTT pLX_317 96.6% 44% V5 (many diffs) n/a
Download CSV