Construct: ORF TRCN0000491302
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012965.1_s317c1
- Derived from:
- ccsbBroadEn_05769
- DNA Barcode:
- AACTCACCTAGCGGTCGATACCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACVR2B (93)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491302
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93 | ACVR2B | activin A receptor type 2B | NM_001106.4 | 99.8% | 100% | 333A>G;1458C>T |
| 2 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007515.2 | 97.2% | 95.7% | (many diffs) |
| 3 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007514.1 | 96.2% | 95.4% | (many diffs) |
| 4 | human | 93 | ACVR2B | activin A receptor type 2B | XM_017007516.1 | 95.9% | 96.3% | (many diffs) |
| 5 | human | 93 | ACVR2B | activin A receptor type 2B | XM_005265583.3 | 95% | 93.9% | (many diffs) |
| 6 | mouse | 11481 | Acvr2b | activin receptor IIB | NM_001313757.1 | 92.1% | 99.4% | (many diffs) |
| 7 | mouse | 11481 | Acvr2b | activin receptor IIB | XM_006511926.3 | 90.5% | 97.8% | (many diffs) |
| 8 | mouse | 11481 | Acvr2b | activin receptor IIB | NM_007397.3 | 87.9% | 94.9% | (many diffs) |
| 9 | mouse | 11481 | Acvr2b | activin receptor IIB | XR_379846.3 | 13.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1605
- ORF length:
- 1536
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacggcgccc tgggtggccc tcgccctcct ctggggatcg ctgtgcgccg 121 gctctgggcg tggggaggct gagacacggg agtgcatcta ctacaacgcc aactgggagc 181 tggagcgcac caaccagagc ggcctggagc gctgcgaagg cgagcaggac aagcggctgc 241 actgctacgc ctcctggcgc aacagctctg gcaccatcga gctcgtgaag aagggctgct 301 ggctagatga cttcaactgc tacgataggc aggagtgtgt ggccactgag gagaaccccc 361 aggtgtactt ctgctgctgt gaaggcaact tctgcaacga gcgcttcact catttgccag 421 aggctggggg cccggaagtc acgtacgagc cacccccgac agcccccacc ctgctcacgg 481 tgctggccta ctcactgctg cccatcgggg gcctttccct catcgtcctg ctggcctttt 541 ggatgtaccg gcatcgcaag cccccctacg gtcatgtgga catccatgag gaccctgggc 601 ctccaccacc atcccctctg gtgggcctga agccactgca gctgctggag atcaaggctc 661 gggggcgctt tggctgtgtc tggaaggccc agctcatgaa tgactttgta gctgtcaaga 721 tcttcccact ccaggacaag cagtcgtggc agagtgaacg ggagatcttc agcacacctg 781 gcatgaagca cgagaacctg ctacagttca ttgctgccga gaagcgaggc tccaacctcg 841 aagtagagct gtggctcatc acggccttcc atgacaaggg ctccctcacg gattacctca 901 aggggaacat catcacatgg aacgaactgt gtcatgtagc agagacgatg tcacgaggcc 961 tctcatacct gcatgaggat gtgccctggt gccgtggcga gggccacaag ccgtctattg 1021 cccacaggga ctttaaaagt aagaatgtat tgctgaagag cgacctcaca gccgtgctgg 1081 ctgactttgg cttggctgtt cgatttgagc cagggaaacc tccaggggac acccacggac 1141 aggtaggcac gagacggtac atggctcctg aggtgctcga gggagccatc aacttccaga 1201 gagatgcctt cctgcgcatt gacatgtatg ccatggggtt ggtgctgtgg gagcttgtgt 1261 ctcgctgcaa ggctgcagac ggacccgtgg atgagtacat gctgcccttt gaggaagaga 1321 ttggccagca cccttcgttG GAGGAGCTGC AGGAGGTGGT GGTGCACAAG AAGATGAGGC 1381 CCACCATTAA AGATCACTGG TTGAAACACC CGGGCCTGGC CCAGCTTTGT GTGACCATCG 1441 AGGAGTGCTG GGACCATGAT GCAGAGGCTC GCTTGTCCGC GGGCTGTGTG GAGGAGCGGG 1501 TGTCCCTGAT TCGGAGGTCG GTCAATGGCA CTACCTCGGA CTGTCTCGTT TCCCTGGTGA 1561 CCTCTGTCAC CAATGTGGAC CTGCCCCCTA AAGAGTCAAG CATCTTGCCA ACTTTCTTGT 1621 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1681 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1741 GAAAGGACGA AACTCACCTA GCGGTCGATA CCATACGCGT TAAGTCgaca atcaacctct 1801 ggattacaaa atttgtgaaa gatt