Construct: ORF TRCN0000491303
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013512.1_s317c1
- Derived from:
- ccsbBroadEn_02973
- DNA Barcode:
- CCTTCTTCCAGCGTACGAAGCAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SH3YL1 (26751)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491303
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_015677.4 | 100% | 100% | |
| 2 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001159597.2 | 94.4% | 94.4% | 781_782ins57 |
| 3 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001282687.1 | 71.9% | 71.6% | 0_1ins285;2_3insTGA |
| 4 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NM_001282682.1 | 66.3% | 66% | 0_1ins285;2_3insTGA;493_494ins57 |
| 5 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104225.1 | 50.3% | 1_309delinsA;1142_1143insGTTG;1331_2025del | |
| 6 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104226.1 | 37.9% | (many diffs) | |
| 7 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104223.1 | 30.2% | 1_1673delinsA;2699_3393del | |
| 8 | human | 26751 | SH3YL1 | SH3 and SYLF domain contain... | NR_104227.1 | 28.6% | (many diffs) | |
| 9 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NM_013709.5 | 86.2% | 92.3% | (many diffs) |
| 10 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NM_001289480.1 | 76.7% | 81.5% | (many diffs) |
| 11 | mouse | 24057 | Sh3yl1 | Sh3 domain YSC-like 1 | NR_110343.1 | 46.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1092
- ORF length:
- 1026
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa taaccctata ccttccaatt tgaaatcaga agcaaaaaag gctgccaaaa 121 tattaagaga attcacagaa ataacttcca gaaatggacc tgataagatc attcctgctc 181 acgtaattgc gaaggctaaa ggccttgcaa ttctgtctgt gatcaaagcc gggttcctgg 241 tgactgccag aggaggcagc gggattgtag tggcgcgcct tccagatgga aaatggtctg 301 caccctcagc cattgggata gctggccttg gtggaggatt tgaaatagga attgaggtat 361 cagacttggt gataattctg aattatgacc gtgctgtaga agcttttgca aaaggcggaa 421 atctgaccct cggagggaac ttgactgtgg cggttgggcc cttgggaagg aacttggaag 481 gaaacgtggc cctgagaagc tccgctgccg tcttcacgta ctgcaagtca aggggactct 541 ttgcaggcgt gtctttagaa gggagctgtt tgattgaaag gaaagaaact aatagaaaat 601 tttattgtca agatatccga gcttatgaca ttttatttgg agatacaccg cggcctgctc 661 aagccgaaga tctttatgaa attcttgatt cctttactga aaagtatgaa aatgaaggac 721 aacgaatcaa tgcaagaaaa gcagcaaggg agcagaggaa gtcttcTGCT AAAGAATTAC 781 CTCCAAAGCC ATTGTCAAGA CCACAGCAGT CATCTGCACC AGTCCAGCTG AACTCTGGCT 841 CTCAAAGTAA CAGAAATGAA TATAAGCTCT ATCCTGGACT TTCCAGCTAT CATGAGAGAG 901 TTGGCAATTT GAATCAACCC ATAGAAGTGA CAGCGCTGTA TTCATTTGAA GGACAGCAGC 961 CTGGGGATTT GAATTTTCAA GCTGGAGACA GAATCACAGT TATATCAAAA ACAGATTCAC 1021 ATTTTGATTG GTGGGAAGGA AAACTTCGAG GTCAAACTGG CATTTTTCCA GCCAACTACG 1081 TAACCATGAA TTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1141 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1201 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCT TCTTCCAGCG TACGAAGCAG 1261 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t