Transcript: Human NM_001284431.1

Homo sapiens UTP15 small subunit processome component (UTP15), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-25
Taxon:
Homo sapiens (human)
Gene:
UTP15 (84135)
Length:
4922
CDS:
653..1639

Additional Resources:

NCBI RefSeq record:
NM_001284431.1
NBCI Gene record:
UTP15 (84135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146697 CAATAAAGACACCCGAGATTA pLKO.1 1239 CDS 100% 13.200 10.560 N UTP15 n/a
2 TRCN0000416616 GAGACTCTCTTTGATACATTA pLKO_005 1708 3UTR 100% 13.200 9.240 N UTP15 n/a
3 TRCN0000427469 GAGTGTTCTGTATCAACATTT pLKO_005 1918 3UTR 100% 13.200 9.240 N UTP15 n/a
4 TRCN0000150190 GCACATGAAGATGAGACAATA pLKO.1 974 CDS 100% 13.200 9.240 N UTP15 n/a
5 TRCN0000129973 GAACACACATCTGATGGATTT pLKO.1 1592 CDS 100% 10.800 7.560 N UTP15 n/a
6 TRCN0000130978 CATGAAGCAACGGGATGACAT pLKO.1 1114 CDS 100% 4.950 3.465 N UTP15 n/a
7 TRCN0000146338 CCAATGGAATACTGAGTGTTA pLKO.1 1008 CDS 100% 4.950 3.465 N UTP15 n/a
8 TRCN0000149092 GTGTTGGAACACACATCTGAT pLKO.1 1586 CDS 100% 4.950 3.465 N UTP15 n/a
9 TRCN0000149983 CATGTTTATGTCTAAGCAGCT pLKO.1 837 CDS 100% 2.160 1.512 N UTP15 n/a
10 TRCN0000148364 CCTAGAATTGTATGACAGGGA pLKO.1 1162 CDS 100% 0.660 0.462 N UTP15 n/a
11 TRCN0000150001 CCGTGACATGTTTATGTCTAA pLKO.1 831 CDS 100% 0.495 0.347 N UTP15 n/a
12 TRCN0000146471 CTTCTGTGTTGGAACACACAT pLKO.1 1581 CDS 100% 0.495 0.347 N UTP15 n/a
13 TRCN0000126745 GCCTGCATATCGAACCTTTAT pLKO.1 1078 CDS 100% 13.200 6.600 Y Utp15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12781 pDONR223 100% 86.7% 86.8% None 1_129del;642A>C n/a
2 ccsbBroad304_12781 pLX_304 0% 86.7% 86.8% V5 1_129del;642A>C n/a
3 TRCN0000491306 ACGATACGAACAACTTCACTAGGC pLX_317 31.5% 86.7% 86.8% V5 1_129del;642A>C n/a
Download CSV