Construct: ORF TRCN0000491307
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017543.2_s317c1
- Derived from:
- ccsbBroadEn_04367
- DNA Barcode:
- CTGGTGAGTTTAATATTTTGTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUDT22 (84304)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491307
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84304 | NUDT22 | nudix hydrolase 22 | NM_001128612.2 | 100% | 100% | |
2 | human | 84304 | NUDT22 | nudix hydrolase 22 | NM_032344.4 | 99.7% | 99.3% | 779A>G;788T>C |
3 | human | 84304 | NUDT22 | nudix hydrolase 22 | NM_001128613.2 | 89.1% | 89.1% | 478_479ins99 |
4 | human | 84304 | NUDT22 | nudix hydrolase 22 | NM_001271831.1 | 89.1% | 89.1% | 478_479ins99 |
5 | human | 84304 | NUDT22 | nudix hydrolase 22 | XM_024448716.1 | 65.1% | 64% | (many diffs) |
6 | human | 84304 | NUDT22 | nudix hydrolase 22 | XM_024448715.1 | 63.6% | 62.5% | (many diffs) |
7 | human | 84304 | NUDT22 | nudix hydrolase 22 | XM_024448714.1 | 57.8% | 56.8% | (many diffs) |
8 | mouse | 68323 | Nudt22 | nudix (nucleoside diphospha... | NM_026675.2 | 83.3% | 79.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 975
- ORF length:
- 909
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcctgaggtg accttgctgc tgcagtgccc tggcgggggc ctgccccagg 121 agcagataca ggccgagctg agccccgccc atgaccgtcg cccactgcca ggtggggacg 181 aggccatcac tgccatctgg gagacccggc taaaggccca accctggctc ttcgacgccc 241 ccaagttccg cctgcactca gccaccctgg cgcctattgg ctctcggggg ccacagctgc 301 tcctgcgcct gggccttact tcctaccgag acttcctggg caccaactgg tccagctcag 361 ctgcctggct gcgacagcag ggtgccaccg actggggtga cacgcaggcc tatctggcgg 421 acccactggg ggtgggcgct gcactagcca cagccgatga cttccttgtc ttcctgcgcc 481 gctcccggca ggtggctgag gcccctgggc tggtggacgt acctggtggg caccctgagc 541 ctcaggccct gtgccctggt ggcagccccc agcaccagga cctcgctggg cagctggtgg 601 tacatgaact cttttccagt gtccttcagg agatctgtga tgaggtgaac ctgccgctgc 661 tcacccTGAG CCAGCCCCTG CTGTTGGGCA TCGCCCGAAA TGAGACCAGT GCTGGCCGAG 721 CCAGTGCCGA GTTCTATGTC CAGTGCAGCC TGACTTCTGA GCAGGTGAGG AAGCACTACC 781 TGAGTGGGGG ACCCGAGGCC CACGAGTCTA CAGGAATCTT CTTTGTGGAG ACACAGAACG 841 TGCGGAGATT GCCCGAGACG GAGATGTGGG CTGAACTCTG CCCCTCGGCC AAAGGCGCCA 901 TCATCCTCTA CAACCGGGTT CAGGGAAGTC CCACTGGAGC GGCCCTAGGG TCCCCAGCCC 961 TACTCCCGCC GCTCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1021 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1081 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTGGTGAGTT TAATATTTTG 1141 TAATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt