Transcript: Human NM_001271831.1

Homo sapiens nudix hydrolase 22 (NUDT22), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
NUDT22 (84304)
Length:
928
CDS:
59..871

Additional Resources:

NCBI RefSeq record:
NM_001271831.1
NBCI Gene record:
NUDT22 (84304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254414 ACACAGAACGTGCGGAGATTG pLKO_005 725 CDS 100% 10.800 15.120 N NUDT22 n/a
2 TRCN0000254417 ACTAGCCACAGCCGATGACTT pLKO_005 436 CDS 100% 4.950 6.930 N NUDT22 n/a
3 TRCN0000254415 CTGTTGGGCATCGCCCGAAAT pLKO_005 575 CDS 100% 3.600 5.040 N NUDT22 n/a
4 TRCN0000254413 AGTCTACAGGAATCTTCTTTG pLKO_005 699 CDS 100% 10.800 7.560 N NUDT22 n/a
5 TRCN0000254416 CATCTGGGAGACCCGGCTAAA pLKO_005 187 CDS 100% 3.600 2.520 N NUDT22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04367 pDONR223 100% 89.1% 89.1% None 478_479ins99 n/a
2 ccsbBroad304_04367 pLX_304 0% 89.1% 89.1% V5 478_479ins99 n/a
3 TRCN0000491307 CTGGTGAGTTTAATATTTTGTAAT pLX_317 34.3% 89.1% 89.1% V5 478_479ins99 n/a
Download CSV