Transcript: Human XM_024448714.1

PREDICTED: Homo sapiens nudix hydrolase 22 (NUDT22), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUDT22 (84304)
Length:
907
CDS:
126..836

Additional Resources:

NCBI RefSeq record:
XM_024448714.1
NBCI Gene record:
NUDT22 (84304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254417 ACTAGCCACAGCCGATGACTT pLKO_005 524 CDS 100% 4.950 6.930 N NUDT22 n/a
2 TRCN0000254413 AGTCTACAGGAATCTTCTTTG pLKO_005 881 3UTR 100% 10.800 7.560 N NUDT22 n/a
3 TRCN0000178961 CTGGTGGTACATGAACTCTTT pLKO.1 768 CDS 100% 4.950 3.465 N NUDT22 n/a
4 TRCN0000254416 CATCTGGGAGACCCGGCTAAA pLKO_005 275 CDS 100% 3.600 2.520 N NUDT22 n/a
5 TRCN0000180925 GCTGGTGGTACATGAACTCTT pLKO.1 767 CDS 100% 4.950 2.970 N NUDT22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04367 pDONR223 100% 57.8% 56.8% None (many diffs) n/a
2 ccsbBroad304_04367 pLX_304 0% 57.8% 56.8% V5 (many diffs) n/a
3 TRCN0000491307 CTGGTGAGTTTAATATTTTGTAAT pLX_317 34.3% 57.8% 56.8% V5 (many diffs) n/a
Download CSV