Construct: ORF TRCN0000491356
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019816.2_s317c1
- DNA Barcode:
- ATCGCTGCCCGGGCTCGGGTGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP30 (84749)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491356
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_032663.5 | 98.1% | 98% | 1_27del;639T>C;1551_1552insG |
| 2 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253962.3 | 97.9% | 97.8% | (many diffs) |
| 3 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_001301175.1 | 95.5% | 95.4% | 0_1ins66;546T>C;1458_1459insG |
| 4 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_006719653.3 | 95.5% | 95.4% | 0_1ins66;546T>C;1458_1459insG |
| 5 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449227.1 | 92.2% | 92.1% | (many diffs) |
| 6 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020048.1 | 91.5% | 91.5% | (many diffs) |
| 7 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020049.1 | 91.4% | 91.3% | (many diffs) |
| 8 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020050.1 | 89% | 89% | (many diffs) |
| 9 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020051.2 | 89% | 89% | (many diffs) |
| 10 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020052.2 | 89% | 89% | (many diffs) |
| 11 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253965.4 | 86.3% | 86.2% | (many diffs) |
| 12 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449228.1 | 83.5% | 83.4% | (many diffs) |
| 13 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020053.1 | 80.5% | 80.5% | (many diffs) |
| 14 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_011538894.2 | 72.3% | 72.2% | (many diffs) |
| 15 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020054.1 | 67.4% | 67.3% | (many diffs) |
| 16 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | NM_001033202.3 | 84.1% | 88% | (many diffs) |
| 17 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_017320581.1 | 83.9% | 87.8% | (many diffs) |
| 18 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_011248156.2 | 62.3% | 64.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 84
- ORF end:
- 1611
- ORF length:
- 1527
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaccaa 61 ctttgggaca aaaagcaggc accatgaccg cggccgacag ggccatccag cgcttcctgc 121 ggaccggggc ggccgtcaga tataaagtca tgaagaactg gggagttata ggtggaattg 181 ctgctgctct tgcagcagga atatatgtta tttggggtcc cattacagaa agaaagaagc 241 gtagaaaagg gcttgtgcct ggccttgtta atttagggaa cacctgcttc atgaactccc 301 tgctacaagg cctgtctgcc tgtcctgctt tcatcaggtg gctggaagag ttcacctccc 361 agtactccag ggatcagaag gagcccccct cacaccagta tttatcctta acactcttgc 421 accttctgaa agccttgtcc tgccaagaag ttactgatga tgaggtctta gatgcaagct 481 gcttgttgga tgtcttaaga atgtacagat ggcagatctc atcatttgaa gaacaggatg 541 ctcacgaatt attccatgtc attacctcgt cattggaaga tgagcgagac cgccagcctc 601 gggtcacaca tttgtttgat gtgcattccc tggagcagca gtcagaaata actcccaaac 661 aaattacctg ccgcacaaga gggtcacctc accccacatc caatcactgg aagtctcaac 721 atccttttca tggaagactc actagtaata tggtctgcaa acactgtgaa caccagagtc 781 ctgttcgatt tgataccttt gatagccttt cactaagtat tccagccgcc acatggggtc 841 acccattgac cctggaccac tgccttcacc acttcatctc atcagaatca gtgcgggatg 901 ttgtgtgtga caactgtaca aagattgaag ccaagggaac gttgaacggg gaaaaggtgg 961 aacaccagag gaccactttt gttaaacagt taaaactagg gaagctccct cagtgtctct 1021 gcatccacct acagcggctg agctggtcca gccacggcac gcctctgaag cggcatgagc 1081 acgtgcagtt caatgagttc ctgatgatgg acatttacaa gtaccacctc cttggacata 1141 aacctagtca acacaaccct aaactgaaca agaacccagg gcctacactg gagctgcagg 1201 atgggccggg agcccccaca ccagttctga atcagccagg ggcccccaaa acacagattt 1261 ttatgaatgg cgcctgctcc ccatctttat tgccaacgct gtcagcgccg atgcccttcc 1321 ctctcccagt tgttcccgac tacagctcct ccacatacct cttccggctg atggcagttg 1381 tcgtccacca tggagacatg cactctggac actttgtcac ttaccgacgg tccccacctt 1441 ctgccaggaa ccctctctca actagcaatc agtggctgtg ggtctccgat gacactgtcc 1501 gcaaggccag cctgcaggag gtcctgtcct ccagcgccta cctgctgttc TACGAGCGCG 1561 TCCTTTCCAG GATGCAGCAC CAGAGCCAGG AGTGCAAGTC TGAAGAAGAC CCAGCTTTCT 1621 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1681 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1741 GTGGAAAGGA CGAATCGCTG CCCGGGCTCG GGTGGGTACG CGTTAAGTCg acaatcaacc 1801 tctggattac aaaatttgtg aaagatt