Construct: ORF TRCN0000491358
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021266.2_s317c1
- DNA Barcode:
- ATTACTGGTTTCGTATTTGGTGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OSGEPL1 (64172)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491358
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NM_022353.3 | 99.9% | 100% | 1026T>C |
| 2 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_005246766.3 | 99.9% | 100% | 1026T>C |
| 3 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_006712685.1 | 99.9% | 100% | 1026T>C |
| 4 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_011511631.1 | 99.9% | 100% | 1026T>C |
| 5 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004676.1 | 99.9% | 100% | 1026T>C |
| 6 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004677.1 | 99.9% | 100% | 1026T>C |
| 7 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004678.1 | 99.9% | 100% | 1026T>C |
| 8 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004679.1 | 99.9% | 100% | 1026T>C |
| 9 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004680.1 | 99.9% | 100% | 1026T>C |
| 10 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NM_001354347.1 | 97.3% | 97.4% | 1_33del;1059T>C |
| 11 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453039.1 | 97.3% | 97.4% | 1_33del;1059T>C |
| 12 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453040.1 | 97.3% | 97.4% | 1_33del;1059T>C |
| 13 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453041.1 | 97.3% | 97.4% | 1_33del;1059T>C |
| 14 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XR_922985.2 | 66% | 1_134del;1160T>C;1377_1880del | |
| 15 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_006712686.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 16 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004681.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 17 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004682.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 18 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004683.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 19 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004684.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 20 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_024453042.1 | 64.4% | 64.4% | 0_1ins441;585T>C |
| 21 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XM_017004685.2 | 60.6% | 59.6% | (many diffs) |
| 22 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | XR_002959323.1 | 58% | 1_207del;1233T>C;1450_2136del | |
| 23 | human | 64172 | OSGEPL1 | O-sialoglycoprotein endopep... | NR_148883.1 | 51.7% | (many diffs) | |
| 24 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | NM_001285839.1 | 85.2% | 85% | (many diffs) |
| 25 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | XM_006496290.3 | 55.7% | 56.2% | (many diffs) |
| 26 | mouse | 72085 | Osgepl1 | O-sialoglycoprotein endopep... | NR_104361.1 | 54.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1314
- ORF length:
- 1242
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctaatc ttgactaaga ctgcaggagt tttttttaaa ccatcaaaaa 121 ggaaagttta tgaattttta agaagtttta attttcatcc tggaacacta tttcttcata 181 aaatagtatt gggaattgaa actagttgtg atgatacagc agctgctgtg gtggatgaaa 241 ctggaaatgt gttgggagaa gcaatacatt cccaaactga agttcattta aaaacaggtg 301 ggattgttcc tccagcagct caacagcttc acagagaaaa tattcaacga atagtacaag 361 aagctctttc tgccagtgga gtctctccaa gtgacctctc agcaattgca actaccataa 421 aaccaggact tgctttaagc ctgggagtgg gcttatcatt tagcttacag ctggtaggac 481 agttaaaaaa gccattcatt cccattcatc atatggaggc tcatgcactt actattaggt 541 tgaccaataa agtagaattt ccttttttag ttcttttgat ttctggaggt cactgtctgt 601 tggcattagt tcaaggagtt tcagattttc tgcttcttgg aaagtctttg gacatagcac 661 caggtgacat gcttgacaag gtggcaagaa gactttcttt aataaaacat ccagagtgct 721 ccaccatgag tggtgggaaa gccatagaac atttggccaa acaaggaaat agatttcatt 781 ttgacatcaa acctcccttg catcatgcta aaaattgtga tttttctttt actggacttc 841 aacacgttac tgataaaata ataatgaaaa aggaaaaaga ggaaggtatt gagaaggggc 901 aaatcctgtc ttcagcagca gacattgctg ccacagtaca gcacacaatg gcatgtcatc 961 ttgtgaaaag aacacatcgg gctattctgt tttGTAAGCA GAGAGACTTG TTACCTCAAA 1021 ATAATGCAGT ACTGGTTGCA TCTGGTGGTG TCGCAAGTAA CTTCTATATC CGCAGAGCTC 1081 TGGAAATTTT AACAAACGCA ACACAGTGCA CTTTGTTGTG TCCTCCTCCC AGACTATGCA 1141 CTGATAATGG CATTATGATT GCATGGAATG GTATTGAAAG ACTACGTGCT GGCTTGGGCA 1201 TTTTACATGA CATAGAAGGC ATCCGCTATG AACCAAAATG TCCTCTTGGA GTAGACATAT 1261 CAAAAGAAGT TGGAGAAGCT TCCATAAAAG TACCACAATT AAAAATGGAG ATATAGAACC 1321 CAGCTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1381 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1441 ATATATCTTG TGGAAAGGAC GAATTACTGG TTTCGTATTT GGTGCAACGC GTTAAGTCga 1501 caatcaacct ctggattaca aaatttgtga aagatt