Construct: ORF TRCN0000491399
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020465.2_s317c1
- DNA Barcode:
- GACATTTTCTAATGCTGGATTATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PFKFB3 (5209)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491399
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_004566.4 | 100% | 100% | |
| 2 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001314063.2 | 98.2% | 97.3% | (many diffs) |
| 3 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016329.2 | 96.3% | 96.3% | 440_441ins57 |
| 4 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001145443.3 | 95.8% | 94.8% | (many diffs) |
| 5 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001282630.2 | 95.4% | 92.7% | (many diffs) |
| 6 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001323016.2 | 94.1% | 92.1% | (many diffs) |
| 7 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001363545.2 | 90.4% | 89.2% | (many diffs) |
| 8 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_005252464.2 | 88.8% | 88.8% | 1341_1342ins174 |
| 9 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016326.2 | 87.1% | 85.9% | (many diffs) |
| 10 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016327.2 | 86.7% | 84.5% | (many diffs) |
| 11 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016328.2 | 84.3% | 83% | (many diffs) |
| 12 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_011519493.2 | 82.1% | 82.1% | 977_978ins105;1236_1237ins174 |
| 13 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001323017.2 | 64.8% | 64.8% | 0_1ins549 |
| 14 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_024448037.1 | 58.3% | 57% | (many diffs) |
| 15 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NR_136554.2 | 28.9% | (many diffs) | |
| 16 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_133232.3 | 88.4% | 97.6% | (many diffs) |
| 17 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177754.1 | 87.3% | 95.5% | (many diffs) |
| 18 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177757.1 | 85.8% | 95% | (many diffs) |
| 19 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177758.1 | 84.8% | 92.5% | (many diffs) |
| 20 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_017315954.1 | 83.9% | 93% | (many diffs) |
| 21 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177755.1 | 83.7% | 92.5% | (many diffs) |
| 22 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177756.1 | 82.7% | 90.5% | (many diffs) |
| 23 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177753.1 | 81.4% | 90% | (many diffs) |
| 24 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177752.1 | 78% | 86.7% | (many diffs) |
| 25 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497367.1 | 78% | 85.2% | (many diffs) |
| 26 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497368.2 | 75.1% | 83% | (many diffs) |
| 27 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497369.2 | 75.1% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1632
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccgttg gaactgacgc agagccgagt gcagaagatc tgggtgcccg 121 tggaccacag gccctcgttg cccagatcct gtgggccaaa gctgaccaac tcccccaccg 181 tcatcgtcat ggtgggcctc cccgcccggg gcaagaccta catctccaag aagctgactc 241 gctacctcaa ctggattggc gtccccacaa aagtgttcaa cgtcggggag tatcgccggg 301 aggctgtgaa gcagtacagc tcctacaact tcttccgccc cgacaatgag gaagccatga 361 aagtccggaa gcaatgtgcc ttagctgcct tgagagatgt caaaagctac ctggcgaaag 421 aagggggaca aattgcggtt ttcgatgcca ccaatactac tagagagagg agacacatga 481 tccttcattt tgccaaagaa aatgacttta aggcgttttt catcgagtcg gtgtgcgacg 541 accctacagt tgtggcctcc aatatcatgg aagttaaaat ctccagcccg gattacaaag 601 actgcaactc ggcagaagcc atggacgact tcatgaagag gatcagttgc tatgaagcca 661 gctaccagcc cctcgacccc gacaaatgcg acagggactt gtcgctgatc aaggtgattg 721 acgtgggccg gaggttcctg gtgaaccggg tgcaggacca catccagagc cgcatcgtgt 781 actacctgat gaacatccac gtgcagccgc gtaccatcta cctgtgccgg cacggcgaga 841 acgagcacaa cctccagggc cgcatcgggg gcgactcagg cctgtccagc cggggcaaga 901 agtttgccag tgctctgagc aagttcgtgg aggagcagaa cctgaaggac ctgcgcgtgt 961 ggaccagcca gctgaagagc accatccaga cggccgaggc gctgcggctg ccctacgagc 1021 agtggaaggc gctcaatgag atcgacgcgg gcgtctgtga ggagctgacc tacgaggaga 1081 tcagggacac ctaccctgag gagtatgcgc tgcgggagca ggacaagtac tattaccgct 1141 accccaccgg ggagtcctac caggacctgg tccagcgctt ggagccagtg atcatggagc 1201 tggagcggca ggagaatgtg ctggtcatct gccaccaggc cgtccTGCGC TGCCTGCTTG 1261 CCTACTTCCT GGATAAGAGT GCAGAGGAGA TGCCCTACCT GAAATGCCCT CTTCACACCG 1321 TCCTGAAACT GACGCCTGTC GCTTATGGCT GCCGTGTGGA ATCCATCTAC CTGAACGTGG 1381 AGTCCGTCTG CACACACCGG GAGAGGTCAG AGGATGCAAA GAAGGGACCT AACCCGCTCA 1441 TGAGACGCAA TAGTGTCACC CCGCTAGCCA GCCCCGAACC CACCAAAAAG CCTCGCATCA 1501 ACAGCTTTGA GGAGCATGTG GCCTCCACCT CGGCCGCCCT GCCCAGCTGC CTGCCCCCGG 1561 AGGTGCCCAC GCAGCTGCCT GGACAAAACA TGAAAGGCTC CCGGAGCAGC GCTGACTCCT 1621 CCAGGAAACA CTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1681 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1741 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GACATTTTCT AATGCTGGAT 1801 TATCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt