Construct: ORF TRCN0000491473
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021747.2_s317c1
- DNA Barcode:
- CCATTGTAACACCCAAATCCCGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- IRF2 (3660)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491473
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3660 | IRF2 | interferon regulatory factor 2 | NM_002199.4 | 100% | 100% | |
| 2 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454034.1 | 100% | 100% | |
| 3 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454035.1 | 100% | 100% | |
| 4 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454036.1 | 100% | 100% | |
| 5 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454037.1 | 99.4% | 99.4% | 526_527insTAGTTG |
| 6 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454038.1 | 99.4% | 99.4% | 526_527insTAGTTG |
| 7 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454039.1 | 84.2% | 84.2% | 362_363ins165 |
| 8 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | NM_008391.4 | 88.8% | 92.5% | (many diffs) |
| 9 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_006509288.3 | 88.8% | 92.5% | (many diffs) |
| 10 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_006509289.3 | 88.8% | 92.5% | (many diffs) |
| 11 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_017312580.1 | 83.7% | 87.2% | (many diffs) |
| 12 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_011242175.2 | 82.2% | 85.6% | (many diffs) |
| 13 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XR_001778407.1 | 31.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1116
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gccggtggaa aggatgcgca tgcgcccgtg gctggaggag cagataaact 121 ccaacacgat cccggggctc aagtggctta acaaggaaaa gaagattttt cagatcccct 181 ggatgcatgc ggctagacat gggtgggatg tggaaaaaga tgcaccactc tttagaaact 241 gggcaatcca tacaggaaag catcaaccag gagtagataa acctgatccc aaaacatgga 301 aggcgaattt cagatgcgcc atgaattcct tgcctgatat tgaagaagtc aaggataaaa 361 gcataaagaa aggaaataat gccttcaggg tctaccgaat gctgccccta tcagaacggc 421 cttctaagaa aggaaagaaa ccaaagacag aaaaagaaga caaagttaag cacatcaagc 481 aagaaccagt tgagtcatct ctggggctta gtaatggagt aagtgatctt tctcctgagt 541 atgcggtcct gacttcaact ataaaaaatg aagtggatag tacggtgaac atcatagttg 601 taggacagtc ccatctggac agcaacattg agaatcaaga gattgtcacc aatccgccag 661 acatttgcca agttgtagag gtgaccactg agagcgacga gcagccggtc agcatgagcg 721 agctctaccc tctgcagatc tcccccgtgt cttcctatgc agaaagcgaa acgactgata 781 gtgtgcccag cgatgaagag agtgccgagg ggcggccaca ctggcggaag aggaatattg 841 aaggcaaaca gtacctcagc aacatggGGA CTCGAGGCTC CTACCTGCTG CCCGGCATGG 901 CGTCCTTCGT CACTTCCAAC AAACCGGACC TCCAGGTCAC CATCAAAGAG GAGAGCAATC 961 CGGTGCCTTA CAACAGCTCC TGGCCCCCTT TTCAAGACCT CCCCCTTTCT TCCTCCATGA 1021 CCCCAGCATC CAGCAGCAGT CGGCCAGACC GGGAGACCCG GGCCAGCGTC ATCAAGAAAA 1081 CATCGGATAT CACCCAGGCC CGCGTCAAGA GCTGTTAGAA CCCAGCTTTC TTGTACAAAG 1141 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1201 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1261 ACGACCATTG TAACACCCAA ATCCCGCAAC GCGTTAAGTC gacaatcaac ctctggatta 1321 caaaatttgt gaaagatt