Construct: ORF TRCN0000491622
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019771.2_s317c1
- DNA Barcode:
- CTCACGAAGCAGTGATTGATGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CMPK1 (51727)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491622
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51727 | CMPK1 | cytidine/uridine monophosph... | NM_016308.3 | 99.5% | 98.6% | 22G>C;91C>T;684_685insG |
| 2 | human | 51727 | CMPK1 | cytidine/uridine monophosph... | NM_001366135.1 | 85.8% | 85.5% | 0_1ins96;588_589insG |
| 3 | human | 51727 | CMPK1 | cytidine/uridine monophosph... | NM_001136140.2 | 78.1% | 77.2% | (many diffs) |
| 4 | human | 51727 | CMPK1 | cytidine/uridine monophosph... | NR_046394.2 | 20.5% | (many diffs) | |
| 5 | mouse | 66588 | Cmpk1 | cytidine monophosphate (UMP... | NM_025647.3 | 89.7% | 85.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 759
- ORF length:
- 687
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctgagc cgctgccgca gccggctgct ccacgtcctg ggccttagct 121 tcctgctgca gacccgccgg ccgattctcc tctgctctcc atgtctcatg aagccgctgg 181 tcgtgttcgt cctcggcggc cccggcgccg gcaaggggac ccagtgcgcc cgcatcgtcg 241 agaaatatgg ctacacacac ctttctgcag gagagctgct tcgtgatgaa aggaagaacc 301 cagattcaca gtatggtgaa cttattgaaa agtacattaa agaaggaaag attgtaccag 361 ttgagataac catcagttta ttaaagaggg aaatggatca gacaatggct gccaatgctc 421 agaagaataa attcttgatt gatgggtttc caagaaatca agacaacctt caaggatgga 481 acaagaccat ggatgggaag gcagatgtaT CTTTCGTTCT CTTTTTTGAC TGTAATAATG 541 AGATTTGTAT TGAACGATGT CTTGAGAGGG GAAAGAGTAG TGGTAGGAGT GATGACAACA 601 GAGAGAGCTT GGAAAAGAGA ATTCAGACCT ACCTTCAGTC AACAAAGCCA ATTATTGACT 661 TATATGAAGA AATGGGGAAA GTCAAGAAAA TAGATGCTTC TAAATCTGTT GATGAAGTTT 721 TTGATGAAGT TGTGCAGATT TTTGACAAGG AAGGCGACCC AGCTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 ACTCACGAAG CAGTGATTGA TGCACACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt