Transcript: Mouse NM_025647.3

Mus musculus cytidine monophosphate (UMP-CMP) kinase 1 (Cmpk1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cmpk1 (66588)
Length:
1880
CDS:
96..779

Additional Resources:

NCBI RefSeq record:
NM_025647.3
NBCI Gene record:
Cmpk1 (66588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025647.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274726 GAAGAAGGGTATCAGCTAATT pLKO_005 1002 3UTR 100% 13.200 10.560 N Cmpk1 n/a
2 TRCN0000025403 ACTTACCTTGAATCAACGAAA pLKO.1 648 CDS 100% 4.950 3.960 N Cmpk1 n/a
3 TRCN0000274785 ACTTACCTTGAATCAACGAAA pLKO_005 648 CDS 100% 4.950 3.960 N Cmpk1 n/a
4 TRCN0000024536 GCCAATGCTCAGAAGAATAAA pLKO.1 432 CDS 100% 15.000 10.500 N LOC243044 n/a
5 TRCN0000274787 TGAGATAACCATCAGTTTATT pLKO_005 383 CDS 100% 15.000 10.500 N Cmpk1 n/a
6 TRCN0000274725 TGACAAAGAAGGCTAACTAAC pLKO_005 764 CDS 100% 10.800 7.560 N Cmpk1 n/a
7 TRCN0000025401 ACTCACAGTATGGTGAACTTA pLKO.1 325 CDS 100% 5.625 3.938 N Cmpk1 n/a
8 TRCN0000006444 GCTGCCAATGCTCAGAAGAAT pLKO.1 429 CDS 100% 5.625 3.938 N CMPK1 n/a
9 TRCN0000342776 GCTGCCAATGCTCAGAAGAAT pLKO_005 429 CDS 100% 5.625 3.938 N CMPK1 n/a
10 TRCN0000025400 CCTTGAATCAACGAAACCAAT pLKO.1 653 CDS 100% 4.950 3.465 N Cmpk1 n/a
11 TRCN0000025399 CCAGACTCACAGTATGGTGAA pLKO.1 321 CDS 100% 4.050 2.835 N Cmpk1 n/a
12 TRCN0000274735 CCAGACTCACAGTATGGTGAA pLKO_005 321 CDS 100% 4.050 2.835 N Cmpk1 n/a
13 TRCN0000006442 CCAAGAAATCAAGACAACCTT pLKO.1 471 CDS 100% 3.000 2.100 N CMPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025647.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08339 pDONR223 100% 90% 90.7% None (many diffs) n/a
2 ccsbBroad304_08339 pLX_304 0% 90% 90.7% V5 (many diffs) n/a
3 TRCN0000467323 ATTATTATTCCCTTCCAGCCTTAG pLX_317 62.5% 90% 90.7% V5 (many diffs) n/a
4 TRCN0000488841 GACCCCCCGTGGTCAGTCCCCGCC pLX_317 56.1% 89.9% 86.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491622 CTCACGAAGCAGTGATTGATGCAC pLX_317 36.1% 89.7% 85.7% V5 (many diffs) n/a
Download CSV