Transcript: Human NR_046394.2

Homo sapiens cytidine/uridine monophosphate kinase 1 (CMPK1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
CMPK1 (51727)
Length:
2860
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046394.2
NBCI Gene record:
CMPK1 (51727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199571 GCCCGCATCGTCGAGAAATAT pLKO.1 313 3UTR 100% 15.000 21.000 N CMPK1 n/a
2 TRCN0000342775 GCCCGCATCGTCGAGAAATAT pLKO_005 313 3UTR 100% 15.000 21.000 N CMPK1 n/a
3 TRCN0000196410 GAGATAGGAATGAGTTCTTAT pLKO.1 2310 3UTR 100% 13.200 18.480 N CMPK1 n/a
4 TRCN0000199021 CAGACCTACCTTCAGTCAACA pLKO.1 632 3UTR 100% 4.950 3.960 N CMPK1 n/a
5 TRCN0000274787 TGAGATAACCATCAGTTTATT pLKO_005 447 3UTR 100% 15.000 10.500 N Cmpk1 n/a
6 TRCN0000196776 GAAATGCATGTGGCTAGATTT pLKO.1 1554 3UTR 100% 13.200 9.240 N CMPK1 n/a
7 TRCN0000006440 CCCTCTAGTAATCACAACATT pLKO.1 1087 3UTR 100% 5.625 3.938 N CMPK1 n/a
8 TRCN0000006444 GCTGCCAATGCTCAGAAGAAT pLKO.1 493 3UTR 100% 5.625 3.938 N CMPK1 n/a
9 TRCN0000342776 GCTGCCAATGCTCAGAAGAAT pLKO_005 493 3UTR 100% 5.625 3.938 N CMPK1 n/a
10 TRCN0000006441 CCTTCAGTCAACAAAGCCAAT pLKO.1 640 3UTR 100% 4.050 2.835 N CMPK1 n/a
11 TRCN0000342706 CCTTCAGTCAACAAAGCCAAT pLKO_005 640 3UTR 100% 4.050 2.835 N CMPK1 n/a
12 TRCN0000195307 CTTGATTGATGGGTTTCCAAG pLKO.1 519 3UTR 100% 4.050 2.835 N CMPK1 n/a
13 TRCN0000006442 CCAAGAAATCAAGACAACCTT pLKO.1 535 3UTR 100% 3.000 2.100 N CMPK1 n/a
14 TRCN0000006443 CCAGATTCACAGTATGGTGAA pLKO.1 385 3UTR 100% 0.405 0.284 N CMPK1 n/a
15 TRCN0000024536 GCCAATGCTCAGAAGAATAAA pLKO.1 496 3UTR 100% 15.000 9.000 N LOC243044 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08339 pDONR223 100% 20.6% None (many diffs) n/a
2 ccsbBroad304_08339 pLX_304 0% 20.6% V5 (many diffs) n/a
3 TRCN0000467323 ATTATTATTCCCTTCCAGCCTTAG pLX_317 62.5% 20.6% V5 (many diffs) n/a
4 TRCN0000491622 CTCACGAAGCAGTGATTGATGCAC pLX_317 36.1% 20.5% V5 (many diffs) n/a
5 TRCN0000488841 GACCCCCCGTGGTCAGTCCCCGCC pLX_317 56.1% 20.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV