Transcript: Human NM_001136140.2

Homo sapiens cytidine/uridine monophosphate kinase 1 (CMPK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CMPK1 (51727)
Length:
2790
CDS:
157..696

Additional Resources:

NCBI RefSeq record:
NM_001136140.2
NBCI Gene record:
CMPK1 (51727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147596 TCAAGGATGGAACAAGACCA pXPR_003 TGG 268 50% 2 0.5713 CMPK1 CMPK1 77300
2 BRDN0001146445 CCAGTGCGCCCGCATCGTCG pXPR_003 AGG 166 31% 1 0.0331 CMPK1 CMPK1 77301
3 BRDN0001145332 AGCAGAGGAGAATCGGCCGG pXPR_003 CGG 68 13% 1 -0.1442 CMPK1 CMPK1 77302
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196410 GAGATAGGAATGAGTTCTTAT pLKO.1 2240 3UTR 100% 13.200 18.480 N CMPK1 n/a
2 TRCN0000196719 GAGATTTGTATTGAACGATGT pLKO.1 478 CDS 100% 4.050 5.670 N CMPK1 n/a
3 TRCN0000342777 GAGATTTGTATTGAACGATGT pLKO_005 478 CDS 100% 4.050 5.670 N CMPK1 n/a
4 TRCN0000199021 CAGACCTACCTTCAGTCAACA pLKO.1 562 CDS 100% 4.950 3.960 N CMPK1 n/a
5 TRCN0000196776 GAAATGCATGTGGCTAGATTT pLKO.1 1484 3UTR 100% 13.200 9.240 N CMPK1 n/a
6 TRCN0000006440 CCCTCTAGTAATCACAACATT pLKO.1 1017 3UTR 100% 5.625 3.938 N CMPK1 n/a
7 TRCN0000006444 GCTGCCAATGCTCAGAAGAAT pLKO.1 346 CDS 100% 5.625 3.938 N CMPK1 n/a
8 TRCN0000342776 GCTGCCAATGCTCAGAAGAAT pLKO_005 346 CDS 100% 5.625 3.938 N CMPK1 n/a
9 TRCN0000199633 GTGGTAGGAGTGATGACAACA pLKO.1 518 CDS 100% 4.950 3.465 N CMPK1 n/a
10 TRCN0000006441 CCTTCAGTCAACAAAGCCAAT pLKO.1 570 CDS 100% 4.050 2.835 N CMPK1 n/a
11 TRCN0000342706 CCTTCAGTCAACAAAGCCAAT pLKO_005 570 CDS 100% 4.050 2.835 N CMPK1 n/a
12 TRCN0000195307 CTTGATTGATGGGTTTCCAAG pLKO.1 372 CDS 100% 4.050 2.835 N CMPK1 n/a
13 TRCN0000006442 CCAAGAAATCAAGACAACCTT pLKO.1 388 CDS 100% 3.000 2.100 N CMPK1 n/a
14 TRCN0000024536 GCCAATGCTCAGAAGAATAAA pLKO.1 349 CDS 100% 15.000 9.000 N LOC243044 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08339 pDONR223 100% 78.3% 78% None 22G>C;170_171ins147 n/a
2 ccsbBroad304_08339 pLX_304 0% 78.3% 78% V5 22G>C;170_171ins147 n/a
3 TRCN0000467323 ATTATTATTCCCTTCCAGCCTTAG pLX_317 62.5% 78.3% 78% V5 22G>C;170_171ins147 n/a
4 TRCN0000488841 GACCCCCCGTGGTCAGTCCCCGCC pLX_317 56.1% 78.2% 77.6% V5 (not translated due to prior stop codon) 22G>C;91C>T;170_171ins147 n/a
5 TRCN0000491622 CTCACGAAGCAGTGATTGATGCAC pLX_317 36.1% 78.1% 77.2% V5 (many diffs) n/a
Download CSV