Construct: ORF TRCN0000491624
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008904.1_s317c1
- Derived from:
- ccsbBroadEn_14172
- DNA Barcode:
- TCTACGATTCAACTCATTTGGCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- APTX (54840)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491624
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54840 | APTX | aprataxin | NM_001369002.1 | 100% | 100% | |
| 2 | human | 54840 | APTX | aprataxin | NM_001369003.1 | 100% | 100% | |
| 3 | human | 54840 | APTX | aprataxin | NM_001369004.1 | 100% | 100% | |
| 4 | human | 54840 | APTX | aprataxin | NM_001369005.1 | 100% | 100% | |
| 5 | human | 54840 | APTX | aprataxin | NM_001370669.1 | 100% | 100% | |
| 6 | human | 54840 | APTX | aprataxin | NM_001370670.1 | 100% | 100% | |
| 7 | human | 54840 | APTX | aprataxin | NM_001370673.1 | 100% | 100% | |
| 8 | human | 54840 | APTX | aprataxin | XM_011517938.2 | 100% | 100% | |
| 9 | human | 54840 | APTX | aprataxin | NM_001195250.2 | 85% | 84.7% | (many diffs) |
| 10 | human | 54840 | APTX | aprataxin | NM_001195254.1 | 85% | 84.7% | (many diffs) |
| 11 | human | 54840 | APTX | aprataxin | NM_001369000.1 | 85% | 84.7% | (many diffs) |
| 12 | human | 54840 | APTX | aprataxin | NM_001369001.1 | 85% | 84.7% | (many diffs) |
| 13 | human | 54840 | APTX | aprataxin | NM_001369006.1 | 80.3% | 79.9% | 609_610insGCTGTGATC;612_613ins141 |
| 14 | human | 54840 | APTX | aprataxin | NM_001195252.2 | 79% | 63.6% | (many diffs) |
| 15 | human | 54840 | APTX | aprataxin | NM_001195248.2 | 74.2% | 74.2% | 1_264del |
| 16 | human | 54840 | APTX | aprataxin | NM_001195249.1 | 74.2% | 74.2% | 1_264del |
| 17 | human | 54840 | APTX | aprataxin | NM_001368995.1 | 74.2% | 74.2% | 1_264del |
| 18 | human | 54840 | APTX | aprataxin | NM_001368996.1 | 74.2% | 74.2% | 1_264del |
| 19 | human | 54840 | APTX | aprataxin | NM_001368997.1 | 74.2% | 74.2% | 1_264del |
| 20 | human | 54840 | APTX | aprataxin | NM_001368998.1 | 74.2% | 74.2% | 1_264del |
| 21 | human | 54840 | APTX | aprataxin | NM_175073.2 | 74.2% | 74.2% | 1_264del |
| 22 | human | 54840 | APTX | aprataxin | NM_001195251.1 | 59.6% | 59.3% | 1_264del;873_874insGCTGTGATC;876_877ins141 |
| 23 | human | 54840 | APTX | aprataxin | NM_001368999.1 | 59.6% | 59.3% | 1_264del;873_874insGCTGTGATC;876_877ins141 |
| 24 | human | 54840 | APTX | aprataxin | NM_175069.3 | 59.6% | 59.3% | 1_264del;873_874insGCTGTGATC;876_877ins141 |
| 25 | human | 54840 | APTX | aprataxin | XM_017014832.1 | 56.1% | 43.7% | (many diffs) |
| 26 | human | 54840 | APTX | aprataxin | XM_017014833.2 | 55.4% | 49.4% | (many diffs) |
| 27 | human | 54840 | APTX | aprataxin | XM_024447578.1 | 53.7% | 46.3% | (many diffs) |
| 28 | human | 54840 | APTX | aprataxin | XM_017014836.2 | 53% | 47.2% | (many diffs) |
| 29 | human | 54840 | APTX | aprataxin | XM_017014831.1 | 51.3% | 42.2% | (many diffs) |
| 30 | human | 54840 | APTX | aprataxin | NR_160930.1 | 40.4% | (many diffs) | |
| 31 | human | 54840 | APTX | aprataxin | NR_160921.1 | 39.9% | (many diffs) | |
| 32 | human | 54840 | APTX | aprataxin | NR_036577.1 | 39.5% | (many diffs) | |
| 33 | human | 54840 | APTX | aprataxin | NR_160926.1 | 39.4% | (many diffs) | |
| 34 | human | 54840 | APTX | aprataxin | NR_160923.1 | 39.1% | (many diffs) | |
| 35 | human | 54840 | APTX | aprataxin | NR_160924.1 | 39% | (many diffs) | |
| 36 | human | 54840 | APTX | aprataxin | XR_929279.1 | 38.1% | (many diffs) | |
| 37 | human | 54840 | APTX | aprataxin | NR_160931.1 | 35.7% | (many diffs) | |
| 38 | human | 54840 | APTX | aprataxin | NR_160922.1 | 35.5% | (many diffs) | |
| 39 | human | 54840 | APTX | aprataxin | NR_160925.1 | 35.4% | (many diffs) | |
| 40 | human | 54840 | APTX | aprataxin | XR_929276.3 | 32.1% | 1_343del;849_1220del;1478_2368del | |
| 41 | human | 54840 | APTX | aprataxin | XR_001746326.2 | 32% | 1_351del;857_1228del;1486_2374del | |
| 42 | human | 54840 | APTX | aprataxin | XR_929277.3 | 31.8% | 1_343del;849_1243del;1501_2391del | |
| 43 | human | 54840 | APTX | aprataxin | XR_001746325.2 | 31.4% | (many diffs) | |
| 44 | human | 54840 | APTX | aprataxin | NR_160920.1 | 27% | 1_330del;607_608ins227;866_1750del | |
| 45 | human | 54840 | APTX | aprataxin | NR_160929.1 | 26.3% | 1_384del;661_662ins227;920_1804del | |
| 46 | human | 54840 | APTX | aprataxin | NR_160928.1 | 24.2% | (many diffs) | |
| 47 | human | 54840 | APTX | aprataxin | NR_160927.1 | 24% | 1_580del;857_858ins227;1116_2000del | |
| 48 | mouse | 66408 | Aptx | aprataxin | NM_001025445.2 | 76.9% | 74.4% | (many diffs) |
| 49 | mouse | 66408 | Aptx | aprataxin | XM_006538171.3 | 76.9% | 74.4% | (many diffs) |
| 50 | mouse | 66408 | Aptx | aprataxin | NM_001025444.3 | 63.7% | 61.5% | (many diffs) |
| 51 | mouse | 66408 | Aptx | aprataxin | XM_006538166.3 | 63.7% | 61.5% | (many diffs) |
| 52 | mouse | 66408 | Aptx | aprataxin | XM_006538167.3 | 63.7% | 61.5% | (many diffs) |
| 53 | mouse | 66408 | Aptx | aprataxin | XM_006538168.3 | 63.7% | 61.5% | (many diffs) |
| 54 | mouse | 66408 | Aptx | aprataxin | XM_006538169.3 | 63.7% | 61.5% | (many diffs) |
| 55 | mouse | 66408 | Aptx | aprataxin | XM_006538170.3 | 63.7% | 61.5% | (many diffs) |
| 56 | mouse | 66408 | Aptx | aprataxin | XM_011250084.2 | 62.8% | 60.6% | (many diffs) |
| 57 | mouse | 66408 | Aptx | aprataxin | NM_025545.4 | 62.5% | 60.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 831
- ORF length:
- 762
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtgaatgaa ctttatccat atattgtaga gtttgaggaa gaggcaaaga 121 accctggcct ggaaacacac aggaagagaa agagatcagg caacagtgat tctatagaaa 181 gggatgctgc tcaggaagct gaggctggga cagggctgga acctgggagc aactctggcc 241 aatgctctgt gcccctaaag aagggaaaag atgcacctat caaaaaggaa tccctgggcc 301 actggagtca aggcttgaag atttctatgc aggaccccaa aatgcaggtt tacaaagatg 361 agcaggtggt ggtgataaag gataaatacc caaaggcccg ttaccattgg ctggtcttac 421 cgtggacctc catttccagt ctgaaggctg tggccaggga acaccttgaa ctccttaagc 481 atatgcacac tgtgggggaa aaggtgattg tagattttgc tgggtccagc aaactccgct 541 tccgattggg ctaccacgcc attccgagta tgagccatgt acatcttcat gtgatcagcc 601 aggattttga ttctccttgc cttaaaaaca aaaaacattG GAATTCTTTC AATACAGAAT 661 ACTTCCTAGA ATCACAAGCT GTGATCGAGA TGGTACAAGA GGCTGGTAGA GTAACTGTCC 721 GAGATGGGAT GCCTGAGCTC TTGAAGCTGC CCCTTCGTTG TCATGAGTGC CAGCAGCTGC 781 TGCCTTCCAT TCCTCAGCTG AAAGAACATC TCAGGAAGCA CTGGACACAG TTGCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGATCTA CGATTCAACT CATTTGGCAA ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt