Construct: ORF TRCN0000491637
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021819.2_s317c1
- DNA Barcode:
- CTCGAAGCCATCATTCTCCAGACG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PPIA (5478)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491637
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5478 | PPIA | peptidylprolyl isomerase A | NM_021130.5 | 100% | 100% | |
2 | human | 729739 | PPIAP46 | peptidylprolyl isomerase A ... | NR_045207.1 | 93.5% | (many diffs) | |
3 | human | 653598 | PPIAL4C | peptidylprolyl isomerase A ... | NM_001135789.3 | 91.9% | 86% | (many diffs) |
4 | human | 653505 | PPIAL4A | peptidylprolyl isomerase A ... | NM_001143883.3 | 91.5% | 85.4% | (many diffs) |
5 | human | 644591 | PPIAL4G | peptidylprolyl isomerase A ... | NM_001123068.1 | 91.3% | 84.2% | (many diffs) |
6 | human | 105371242 | PPIAL4H | peptidylprolyl isomerase A ... | NM_001368128.1 | 91.1% | 84.2% | (many diffs) |
7 | human | 730262 | PPIAL4E | peptidylprolyl isomerase A ... | NM_001144032.2 | 90.9% | 84.2% | (many diffs) |
8 | human | 728945 | PPIAL4F | peptidylprolyl isomerase A ... | NM_001164262.2 | 90.9% | 84.2% | (many diffs) |
9 | human | 645142 | PPIAL4D | peptidylprolyl isomerase A ... | NM_001164261.1 | 90.7% | 83.6% | (many diffs) |
10 | human | 5478 | PPIA | peptidylprolyl isomerase A | XM_024446808.1 | 89% | 81.7% | (many diffs) |
11 | human | 100192204 | PPIAP30 | peptidylprolyl isomerase A ... | NR_036506.1 | 71.2% | (many diffs) | |
12 | human | 5478 | PPIA | peptidylprolyl isomerase A | NM_001300981.2 | 63.6% | 63.6% | 0_1ins180 |
13 | human | 5478 | PPIA | peptidylprolyl isomerase A | XM_024446809.1 | 63.6% | 63.6% | 0_1ins180 |
14 | human | 5478 | PPIA | peptidylprolyl isomerase A | XR_002956460.1 | 29% | 1_765del;952_1172del;1482_1704del | |
15 | human | 284996 | RNF149 | ring finger protein 149 | XR_001738713.2 | 16.5% | (many diffs) | |
16 | mouse | 268373 | Ppia | peptidylprolyl isomerase A | NM_008907.1 | 91.9% | 95.7% | (many diffs) |
17 | mouse | 668548 | Gm9234 | predicted pseudogene 9234 | XR_869917.3 | 60.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 567
- ORF length:
- 495
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggtcaac cccaccgtgt tcttcgacat tgccgtcgac ggcgagccct 121 tgggccgcgt ctcctttgag ctgtttgcag acaaggtccc aaagacagca gaaaattttc 181 gtgctctgag cactggagag aaaggatttg gttataaggg ttcctgcttt cacagaatta 241 ttccagggtt tatgtgtcag ggtggtgact tcacacgcca taatggcact ggtggcaagt 301 ccatctatgg ggagaaattt gaagatgaga acttcatcct aaagcatacg ggtcctggca 361 tcttgtccat ggcaaatgct ggacccaaca caaatggttc ccagtttttc atcTGCACTG 421 CCAAGACTGA GTGGTTGGAT GGCAAGCATG TGGTGTTTGG CAAAGTGAAA GAAGGCATGA 481 ATATTGTGGA GGCCATGGAG CGCTTTGGGT CCAGGAATGG CAAGACCAGC AAGAAGATCA 541 CCATTGCTGA CTGTGGACAA CTCGAATAGA ACCCAGCTTT CTTGTACAAA GTGGTTGATA 601 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 661 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACTCGA 721 AGCCATCATT CTCCAGACGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 781 tgaaagatt